Observation 209580: Leucoagaricus Locq. ex Singer
When: 2015-07-10
No herbarium specimen
0 Sequences

Notes:
Growing in mixed hardwoods on the edge of the botanic garden.

Images

739413
537215=2.jpg
537214
DSC_4043.JPG
537215
DSC_4045.JPG
537216
DSC_4049.JPG
natural light
537220
DSC_4054.JPG
Gill edge 400x
537221
DSC_4055.JPG
Spores 1000x

Proposed Names

29% (1)
Recognized by sight
87% (1)
Eye3 Eyes3
Used references: Else Vellinga

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF062575
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 05:03:37 PDT (-0700)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2017-05-07 03:43:30 PDT (-0700)

CCTCGATGGGTTGTAGCTGGCCTCTTGAGGCATGTGCACGCCTGTCTTGACTCTATTCATCCACCTGTGCACCTATTGTAGTTTCTTACTCTTCGATGGTCAAGGAAATTCGGTTGTAGTTCAGTTGAAATATACTGGATTTGAGGATTGCTGTTTGGCTTTTCTCTACCTCGCCTTATGAAATTGTCCATTTCGAGAAGGAGGCTATGTCTTTTACCATAAACCACGTATGTCGCCAGAATGTAGTTAATGGGCCTTTGTGCCTATAAAACCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAGTAAATTCTCAACCTCTCCAGCTTTTCTGTTGGGTAAGAGGCTTGGATCTGGAGGTGTTGTCGGCCTTTATCAGGTTGACTCCTCTGAAATACATTAGCGGAACCGTTTGCGATCCTTCACAGGTGTGATAATTATCTACGCCATTGGATTGCTCTCTGTGTTGTTCAGCTGCCAACCGTCCGTAAGGACAACCATTACTGATTATTT

Created: 2015-07-11 13:32:28 PDT (-0700)
Last modified: 2017-05-19 05:03:15 PDT (-0700)
Viewed: 64 times, last viewed: 2017-06-20 07:13:53 PDT (-0700)
Show Log