Observation 237290: Morchella importuna M.Kuo, O’Donnell & T.J.Volk
When: 2016-04-14
0 Sequences

Notes:
Kava Turtle collection, from the Lake County fire.

Photos taken in the lab a couple days after collection.

Proposed Names

-44% (2)
Based on chemical features: Possible ITS match
55% (1)
Recognized by sight
92% (2)
Eye3 Eyes3
Based on chemical features: 100% ITS match with KM204675

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF073271
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 08:09:45 CDT (-0400)
likely? no.
By: Debbie Viess (amanitarita)
2016-04-28 14:34:04 CDT (-0400)

possible? maybe.

according to you, your DNA “match” was iffy.

at best, you should vote this a “could be.”

I think it is likely
By: Alan Rockefeller (Alan Rockefeller)
2016-04-28 12:55:47 CDT (-0400)

Some morels do have worldwide distribution.

a Czech morel in CA??!
By: Debbie Viess (amanitarita)
2016-04-26 13:56:44 CDT (-0400)

not very likely.

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-25 00:15:31 CDT (-0400)

AGGGCAGCCGAGGGGCCACCAGGGCTAGTAGCTTTACGTTGTTGAACGTCCTGGCCGGACC
CGGAGCCGCCCCCATCTAAACCCTCTGCGTACCTGTCCCGCCTTGCTTCCCCTGGCTACCAGCTGGGGGGAGGAACAACA
ACCAAAACTCTTTGTGAACAAACCGACGTCAGAATCATAACAAAACAAAAAAGTTAAAACTTTCAACAACGGATCTCTTG
GTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA
ACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTGAT
TACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTAGTTTCCCAATGTCCTAAATAGACGTAGACCCG
CCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATATAGGCTTGCAGTAAAATGCTCACCTTTCT
CCATACGCCGATGGCACACCGGTCGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCAC
CATACACAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAT

Created: 2016-04-25 00:13:47 CDT (-0400)
Last modified: 2017-06-27 20:58:24 CDT (-0400)
Viewed: 123 times, last viewed: 2017-10-15 17:26:49 CDT (-0400)
Show Log