Observation 237290: Morchella importuna M.Kuo, O’Donnell & T.J.Volk

Notes:
Kava Turtle collection, from the Lake County fire.

Photos taken in the lab a couple days after collection.

Species Lists

Images

613355
DSC_9158.JPG
613351
DSC_9154.JPG
613352
DSC_9155.JPG
613353
DSC_9156.JPG
613354
DSC_9157.JPG

Proposed Names

-44% (2)
Based on chemical features: Possible ITS match
55% (1)
Recognized by sight
92% (2)
Eye3 Eyes3
Based on chemical features: 100% ITS match with KM204675

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF073271
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 05:09:45 PDT (-0700)
likely? no.
By: Debbie Viess (amanitarita)
2016-04-28 11:34:04 PDT (-0700)

possible? maybe.

according to you, your DNA “match” was iffy.

at best, you should vote this a “could be.”

I think it is likely
By: Alan Rockefeller (Alan Rockefeller)
2016-04-28 09:55:47 PDT (-0700)

Some morels do have worldwide distribution.

a Czech morel in CA??!
By: Debbie Viess (amanitarita)
2016-04-26 10:56:44 PDT (-0700)

not very likely.

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-24 21:15:31 PDT (-0700)

AGGGCAGCCGAGGGGCCACCAGGGCTAGTAGCTTTACGTTGTTGAACGTCCTGGCCGGACC
CGGAGCCGCCCCCATCTAAACCCTCTGCGTACCTGTCCCGCCTTGCTTCCCCTGGCTACCAGCTGGGGGGAGGAACAACA
ACCAAAACTCTTTGTGAACAAACCGACGTCAGAATCATAACAAAACAAAAAAGTTAAAACTTTCAACAACGGATCTCTTG
GTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA
ACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTGAT
TACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTAGTTTCCCAATGTCCTAAATAGACGTAGACCCG
CCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATATAGGCTTGCAGTAAAATGCTCACCTTTCT
CCATACGCCGATGGCACACCGGTCGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCAC
CATACACAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAT

Created: 2016-04-24 21:13:47 PDT (-0700)
Last modified: 2017-06-27 17:58:24 PDT (-0700)
Viewed: 128 times, last viewed: 2018-01-19 10:31:31 PST (-0800)
Show Log