Observation 238966: Psilocybe fagicola R. Heim & Cailleux

Notes:
Under Quercus and Oreomunnea.

Taste farinaceous, like cucumber.

Species Lists

Images

618438
DSC_3584_2_modified.JPG
618436
DSC_3590_1_modified.JPG
618437
DSC_3584_1_modified.JPG
618439
DSC_3582_1.JPG
678893
better-tree.jpg
A better tree

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
16
By: Alan Rockefeller (Alan Rockefeller)
2016-10-22 05:58:38 CEST (+0200)

There are about 50 names published for Psilocybe in Mexico, and of those 16 are valid taxa. I have photos of 13 of them, lacking P. meridionalis, P. moseri and P. hoogshagenii in the wild.

Regarding potency, I am not sure. Last year I ate a couple and felt different but it wasn’t really enough to get a sense of how strong they are. I could send some to Jan Borovicka, he is doing a psilocybin mushroom potency study right now using GC/MS.

The mystical healers probably started discovered psilocybin by collecting mushrooms for the table and accidentally hallucinating. The Psilocybes that grow in Mexico can be quite large and prolific, unlike the little brown ones that are found in the USA. Once they found one species the others could be determined by odor, spore color and blue staining.

potency
By: AmatoxinApocalypse (AmatoxinApocalypse)
2016-10-20 15:37:16 CEST (+0200)

I would be curious about the amount of psilocybin/psilocin in the different species of Psilocybe you observer in Mexico.

Some of them appear to bruise blue heavily, and I thought that was due to a larger concentration of psilocin, while some don’t appear to bruise blue that much, if at all.

If memory serves me correct, the higher the psilocin content, the more bluing is observed? While collections higher in psilocybin, like Panaeolus cinctulus or Psilocybe semilanceata, don’t bruise blue as readily.

I know bluing is no indicator of potency, but am curious if this bluing had any impact on the local healers that have used such mushrooms for divination purposes. I know Wasson(?) thought they only used a handful of Psilocybe sp., but am curious if they knew about many more, and if they knew about them because they were looking for blue staining, or by trial and error, trying certain mushrooms to see if they experienced mystical states after consumption.

I would hate to be the guy trying random shrooms back in the day, talk about a labor of love :)

Anyway, this is an interesting collection because of how Mycenoid it appears, very cool.

Any estimates how many Psilocybe species there are in Mexico?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-18 05:21:14 CEST (+0200)

TGGCTTGGTTGTGCTGGTCCTCTCGAGGACATGTGCATGCCTTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGTTATAGTGAACGGGAGAGCGTGCTCTCCTCGAAGCTATGCTAGGCCTATGTTTTCATATACCCCAAAGAATGTAATAGAATGTGTTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTAATAGCTTTTGCTGTTAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTATGTCGGCTCCCCTCAAATGTATTAGCCGGTACCCTGCGTGGCCGTCTATTAGTGTGATAATTATCTACGCTATTAGACCTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTGGACATACAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAA

Created: 2016-05-18 05:12:45 CEST (+0200)
Last modified: 2018-03-22 11:53:12 CET (+0100)
Viewed: 121 times, last viewed: 2018-04-19 04:56:08 CEST (+0200)
Show Log