Observation 239044: Morchella importuna M.Kuo, O’Donnell & T.J.Volk
When: 2016-04-23
(40.3469° -123.3931° 1060m)

Notes: Found in burned out stump depression that based upon needles I think was a fir tree. Location was in the middle of a fire – hot area as everything was scorched, no needles etc on the surrounding area

I gave a portion of the collection to Alan Rockefeller for sequencing and he recovered a really strong read back from it for ITS:

GGCAGCCGAGGGGCCACCAGGGCTAGTAGCTTTACGTTGTTGAACGTCCTGGCCGGACCCGGAGCCGCCCCCATCTAAACCCTCTGCGTACCTGTCCCGCCTTGCTTCCCCTGGCTACCAGCTGGGGGGAGGAACAACAACCAAAACTCTTTGTGAACAAACCGACGTCAGAATCATAACAAAACAAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTGATTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTAGTTTCCCAATGTCCTAAATAGACGTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATATAGGCTTGCAGTAAAATGCTCACCTTTCTCCATACGCCGATGGCACACCGGTCGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCACCATACACAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGG

Alan notes that it 100% hits this other Morchella from the Lake County fire:
http://mushroomobserver.org/237290

Original observation was in iNaturalist because of ease upload:
http://www.inaturalist.org/observations/3027504

Proposed Names

53% (1)
Eye3
Recognized by sight
91% (2)
Eyes3
Based on chemical features: 100% ITS match with KM204675

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF073270
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 06:08:45 MDT (-0600)

Created: 2016-05-19 14:06:58 MDT (-0600)
Last modified: 2017-05-19 09:15:38 MDT (-0600)
Viewed: 82 times, last viewed: 2017-08-28 18:59:18 MDT (-0600)
Show Log