Observation 244111: Xerocomus Quél.
When: 2016-07-12

Notes: > Growing on a steep hill under beech and oak trees.
> My best guess this is something in the X. subtomentosus group.
> Overall this mushroom was “painted” in brown tones, even the pore surface, and from a distance it looked like a Porphyrellus sp.
> The pores didn’t stain blue when bruised and neither did the exposed pale yellow context.
> The ammonia test on cap gave a complex picture. I think there was a instant flash of very dark green-blue. The cap cuticle under the reagent turned mahogany red, then deep rusty orange; the blotted surface was dingy yellow. There was a persistent deep blue halo around the reagent drop, eventually resolving green.

DNA Results and Discussion (Feb-1-2017):
> A clean, contiguous, 803 bps long nrITS sequence was obtained for this material. In addition, the first 145 characters of the nrLSU sequence were procured.
> A GenBank BLAST search of the full-length nrITS sequence gave an almost perfect match with a Boletus subtomentosus voucher F:PRL5774MAN (accession #GQ166882; 891 bps long) collected from Bailly Cemetery in Indiana Dunes State Park, IN: 802/803 = 99.9% similarity, no gaps. The remaining hits featured, by and large, sequences of various Xerocomus species with an overlay of only 45-77% of the subject sequence and similarity in the 84-93% range. Gaps comprised close to 50% of mismatching events.
> The above results can be interpreted quite unambiguously: MO244111 likely represents an undescribed North American Xerocomus species. DNA pretty much confirms what the morphology already conveyed to the eye. The bolete voucher collected in Indiana is almost certainly the same species. The name X. subtomentosus obviously doesn’t apply to this entity as the former bolete is a well known, extensively studied taxon, and happens to be the type species of the genus Xerocomus sensu stricto, with numerous nrITS sequences posted to GenBank.

Species Lists

Images

634772
634774
White areas are slug damage
634775
634776
634778
634779
Ammonia on cap, ~20-30 sec after application
634780
Ammonia on cap, ~1 min after application
634784
No bluing of the context

Proposed Names

28% (1)
Recognized by sight
57% (1)
Eye3 Eyes3
Based on chemical features: ITS sequence likely places it in Xerocomus

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
nrITS sequence MO244111
By: I. G. Safonov (IGSafonov)
2017-02-01 22:43:15 EST (-0500)

CTGCGGAAGGATCATTATAGAATATATTTCAAAACGGAATGGGTTTAGAGAGACTGTCGCTGGCTTGGATTTCAATTTCGATTTCAATGCATGTGCACGCCTCTCACCCTTTCCCTTTCTGAACTACACACACTAGTGCACCTATTGTAGATCCACTCGAAAGAGTGAGATCTATGTTTTTCATCTCATCACACACATAGTATGTCTAGAATGTCATTTTATCTAACAAGACTTTCGGGTCTGTTGATAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTCCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCATTCTCTTGATTAATCTTCAAGAGATCATGGCTTGGAATTGGGGGTTGCTGGCGAGACTTGTCAGCTCTCCTTAAATGCATTAGCGATGTGTTGGCTAGTCTTTGACGTACACGGCCTTCGATGTGATAATGATCGTCGTGGCTGGAGCGTCTTTCAGACTATGCACATAGATCATTGCTTCTAACCTGAATTGAATTGAATTGAAGGAAGAAGTAGGGTGGAGTCCAAAGTCCAAAGTCCATCAAGCTTAGCTACTAGGCAGTCTTTACTACAAAGGGCTGGCGAACACGAGCAAGATGATAAGACAAAAGACAAGCTTGTTCCCCTCCCCGCTCCTTTTCCCCTTCATATTCATACTTCATACATTTAGAGAC

Created: 2016-07-13 00:10:32 EDT (-0400)
Last modified: 2017-02-01 22:45:10 EST (-0500)
Viewed: 65 times, last viewed: 2017-07-17 14:53:37 EDT (-0400)
Show Log