Observation 250839: Butyriboletus taughannockensis Safonov
When: 2016-08-26

Notes: Description (transcribed from short-hand field notes, with additional details inferred from photographs):

Pileus: Up to 14 cm (5.5”) wide at maturity, ¾ spherical at first, then hemispherical and finally broadly plano-convex; margin incurved at first, becoming de-curved, typically uneven and wavy all around or at least partially, with a prominent, curved band of sterile tissue present at first but generally disappearing in age; pellicle dry, faintly tomentose to minutely scruffy on the disk and almost smooth toward the margin at first, becoming uniformly smooth, bald and minutely rimose-areolate toward the periphery at maturity, covered with appressed, short, dark and interwoven fibrils and tiny scruffy tufts when young and fresh (the fibrils generally oriented radially from the disk center, taking on the appearance of being merely “painted” in the two older basidiomes), rich chamoisse to pinkish cocoa brown when young, becoming lighter in age on the disk and turning yellowish-brown toward the periphery, not discoloring in any way when touched or bruised; context dense and firm when young and less so in age, light to medium lemon yellow immediately above the tubes and more or less homogeneously paler yellow above when young, becoming faintly yellow maturity, not changing color at all when exposed to air, with light brownish-burgundy discoloration around larval tunnels; odor not distinct to faintly pleasant and somewhat fungal; taste mild at first, with a sour/lemony note perceived in a few seconds, and then becoming mild to non-distinct again (tasting caused a minor and reversible ulceration of the tip of the tongue).
Hymenophore: pore surface medium honey yellow to dingy egg-yolk yellow at first, becoming rich butter yellow and finally greenish mustard yellow at maturity, not bluing when touched or bruised, but the ground color merely intensifying upon injury, uniformly smooth when immature and prominently bumpy/pitted and uneven in age; pores closed and shut when young, circular to oval and 1-2 per mm at maturity; tubes 1 mm deep when very young and up to 17 mm deep at maturity, more or less concolorous with the pore surface, not bluing or discoloring when cut or exposed to air.
Stipe: Up to 10 cm (~4”) long; up to 1.8 cm (0.71”) wide at apex, up to 2.2 cm (0.87”) wide in the middle, and up to 3.2 cm (1.26”) wide at base [these dimensions correspond to the stipe of the largest immature plant, as it’s actually longer and thicker than that of the oldest specimen], oval-shaped in cross-section in all specimens, clavate to subclavate to almost equal, with a somewhat bulbous base, L-shaped to slightly bent to shallowly S-shaped to almost straight; surface uniformly pale/dull lemon yellow, with a brighter, richer yellow apex and with the base/bulb covered with a whitish bloom at first, gradually and uniformly assuming a light pinkish-brown or light vinaceous-brown coloration from the base all the way up to the apex in age, with a few random darker vinaceous-burgundy stains/areas when young, not bluing when handled or injured, prominently but not coarsely reticulated from the apex down to at least mid-length; reticulation somewhat raised, mesh small and very densely weaved in the apex, becoming wider-meshed and progressively elongated below, gradually changing over to a network of raised longitudinal ridges and then trailing off to a smooth surface toward the base, generally concolorous with the background color or slightly darker (especially after being handled); context generally whitish to grayish in the cortex, increasingly pale grayish-brown toward the base and in the bulb, with a continuous and narrow (2-3 mm) light to medium lemon-yellow band just below the stipe surface stretching from the juncture with the cap down to ⅔ of length, not bluing when exposed to air, firm and dense most specimens and more spongy-fibrous in the youngest one.
Spore print color: Light greenish olive.
Macrochemical tests: KOH = medium brown quickly changing to rusty orange-brown on pellicle; dark honey yellow-brown on cap context; pale orange on stipe context. NH3 (aq.) = rusty orange-brown on pellicle (similar to KOH reaction), flashing instantly with a wide vinaceous-purple halo around the droplet due to the ammonia vapors; pale yellow to pale greenish mustard yellow on cap context; pale orange on stipe context (similar to KOH reaction); FeSO4 = instantly grayish olive-green on pellicle; same but lighter on cap context; faint greenish-olive on stipe context.
Microscopic features: Mounted in Melzer’s, [40/1/1]; L x W = (10.1-) 10.5-12.8 (-13.3) x 3.5-4.0 (-4.3) μm; L’ x W’ = 11.4 × 3.7 μm; Q = (2.75-) 2.81-3.41 (-3.50); Q’ = 3.07; not amyloid, not dextrinoid, light buff to light straw, inequilateral, fusiform in face-view and subfusiform in lateral-view, smooth and thin-walled, cylindrical to bacilliform based on the Q-ratio range.
Fruiting: A single post-mature specimen growing in a few yards away from a group of 3 immature specimens in leaf litter in a stand of mostly young and old oaks mixed in with other young hardwood trees next to the South Rim Trail. The woods on the southern side of the gorge circumscribed by the trail and paved Gorge Road range from pure hemlock stands (the trailhead section), to a mixed hemlock-hardwood forest to extensive areas of thin, exclusively deciduous woodlands. No hemlocks or other conifers were observed in the vicinity of the collection location.
Comments: The post-mature fruiting body was discovered first. Originally, it gave a strong impression of an old B. separans, owing to the coloration of the cap and stipe, and was almost discarded. Searching the immediate area led to the detection of the three young specimens at the base on an oak tree. The connection between the two collections was not immediately recognized, despite their proximity, as the immature fruiting bodies looked nothing like the aged one, till the specimens were examined more closely. The identical chemicals tests (on the pellicle) helped confirm both collections are very likely to be the same taxon.

Sequencing Results and Discussion:
>> A clean and contiguous 1438 bps nrLSU sequence has been obtained for this material and posted to this observation in the comment below.
A GenBank BLAST search of the full-length sequence did not return any meaningful hits, which is consistent with most, if not all, full-length sequences I ever ran through GB.
A search a sequence fragment (the first 978 bases) was more successful: the first 32 hits (97-99% identity) were all members of Butyriboletus. Interestingly, the top two hits were R. Chapman’s Butyriboletus pulchriceps vouchers (867/876 = 99.0% similarity, no gaps; 888/898 = 98.9% similarity, 1 gap).
B. pulchriceps has recently been transferred to Butyriboletus together with two other North American taxa, Caloboletus peckii and B. roseopurpureus, by Zhao et al. (2015) based on molecular sequencing of relevant vouchers. I have already expressed my skepticism with regard to the transfer of peckii to Butyriboletus in light of the evidence from obs 246697, which I think is a good candidate for Peck’s Bolete. B. roseopurpureus is an outlier to Butyriboletus in the Butter bolete study of Arora and Frank (2014).
>> A 690 bps nrITS sequence was also procured for this material. Apparently, there was a non-specificity problem that precluded obtaining a contiguous end-to-end read. Hence, the present sequence is the merger of forward and reverse reads “stitched” at a problematic homopolymeric region. The overall quality of this sequence is very good.
The nrITS sequence was subjected to a BLAST GB database search. After analyzing the alignments, the unusual “deca-T” motif present in the middle of the sequence read of MO250839 (a string of 10 consecutive thymines) was identified as a problematic region, responsible for some of the observed deletions and insertions seen in the GB sequences. Still, notwithstanding the lower GB identity scores stemming for this problem, the BLAST list of the 100 top-scoring hits was exclusively comprised of members of Butyriboletus. Examination of the GB data revealed that the poly-T motif (usually 5 or 6 T’s in most Butter Boletes and as many as 9 consecutive T’s in But. pulchriceps, acccession #KT002604) appears to be a defining genetic feature seen in Butyriboletus.

Conclusions: MO250839 has all the major phenotypic hallmarks of a Butter Bolete. The nrLSU and nrITS sequencing data are also in good agreement with this proposal. The combination of morphological traits and molecular data both indicate that MO250839 is a novel species belonging in Butyriboletus. The closest genetic relative appears to be Butyriboletus pulchriceps. In light of the above information, I propose Butyriboletus taughannockensis Safonov, sp. nov. for this taxon. This name has been registered with Index Fungorum.
An IF Nomeclatural Novelty e-publication has just been published (1-18-17): http://www.indexfungorum.org/....

Images

656074
Flash on; ISO=160 (close to natural colors)
656182
Flash on; ISO=200
656183
Flash on; ISO=100 (colors close to natural)
656184
Flash on
656185
Flash on
656186
Natural light; ISO=320 (slightly overexposed)
656187
Natural light; ISO=320
656188
Natural light; ISO=250
656189
Natural light; ISO=200
656190
Natural light; ISO=250
656191
Natural light; ISO=250
656192
Flash on; ISO=100
656193
Flash on; ISO=125
656194
Natural light; ISO=160
656195
Natural light; ISO=400
656196
Natural light; ISO=250; KOH = honey yellow-brown
656199
Left to right: FeSO4 = grayish olive green; NH3 = rusty brown with a lilac “aura” due to vapors; KOH = amber brown changing quickly to brigh orange brown; photographed with flash on
656200
Flash on; taken the next day
656201
Flash on; taken the next day
662856
Mounted in Melzer’s and viewed at x400
662857
Mounted in Melzer’s and viewed at x1000

Proposed Names

31% (2)
Recognized by sight
85% (1)
Eye3 Eyes3
Recognized by sight: Mophology consistent with an undescribed taxon
Based on chemical features: Molecular data

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Nice work, Igor!
By: Dave W (Dave W)
2017-01-20 09:56:59 CST (-0500)

There are some really nice foraying spots in the Binghamton/Ithaca area… Buttermilk Falls State Park (I like the upper area), the “Nature Preserve” at Binghmaton University, Chenango Valley SP. And, just to the south of Binghamton in PA, Salt Springs SP features a stand of hemlock that reportedly includes trees over 500 years old.

thanks for clearing that up Igor
By: Debbie Viess (amanitarita)
2017-01-18 14:35:08 CST (-0500)

and special thanks for that help with the pronunciation. ;)

Yur funny!

Thanks, Debbie
By: I. G. Safonov (IGSafonov)
2017-01-18 14:08:32 CST (-0500)

I agree that the name looks like a mouthful, but I rarely make things simple for others. :-) Of course, I have nothing to do with the genus name.
I have an acquaintance who has a summer retreat near Ithaca. He told me that the locals have a certain way of pronouncing “taughannock”. If my use of pronunciation symbols is correct, the name should sound something like [tə’gænɔː’kensəs].

Dr. Redhead,
By: I. G. Safonov (IGSafonov)
2017-01-18 14:04:26 CST (-0500)

Yes, I will need to find out how to deposit sequences into GenBank. Last I head it wasn’t that trivial, so I would appreciate any help from you in guiding me to the right information. I have quite a few sequences, most of which are already on MO, and expect more to come later this year. Thus, it would be useful to link the info in MO with GenBank for this and other observations for which I have molecular data. I will also contact Dr. Halling to investigate the possibility of getting part of this collection into the NYBG herbarium.

Sequences and type
By: S. Redhead (Scott)
2017-01-18 13:44:11 CST (-0500)

Thank you for adding sequences but I would hope that you would deposit them in something like GenBank so that others are aware of them and that you deposit the type or a part in a herbarium, such as the New York Bot. Garden.

congrats Igor!
By: Debbie Viess (amanitarita)
2017-01-18 13:21:51 CST (-0500)

but that name is quite a mouthful!

nrLSU sequence MO250839
By: I. G. Safonov (IGSafonov)
2017-01-18 12:24:20 CST (-0500)

TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACYAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTTGAATCTGGCAGTCCTTGGCTGTCCGAGTTGTAATCTAGAGAAGTGTTTTCCGCGCTGGTCCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGCTGGGGATCAACCTTGCTTTTCGCTGGGTGTACTTCCCGGTCGACGGGTCAGCATCAGTTTCAGTCATCGTACAAGGGTGAGGGGAACGTGGCACTCTCCGGAGTGTGTTATAGCCTTTCATCATATGCGGTGGTCGGGACTGAGGAGCTCAGCACGGCTTCGGCTTGTGCTCAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGTAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCATGGAGGGCATCGACGCCCGGACCTGAGTCTTTGACGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTTGTTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCGTCAGCGTTGAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGTGAAGAAGCCTTGGCAGCGATGCTGGGTGGAACCGCCTCTAGT

nrITS sequence MO250839
By: I. G. Safonov (IGSafonov)
2017-01-18 12:23:14 CST (-0500)

CTGCGGAAGGATCATTATTGAATTCTGAGAGGGAAGACCGAGGGGTGGAGACTGTTGCTGGCCCTCCCTGGGGCATGTGCACGTCTTCCTTTTCGTCGACCTTTCTCACACACAACACACCTGTGCACCTGTTGTAGGTTCTCGAAAGAGGATCTATGTTTTTCACATCACACACCATCGTATGTCTATAGAATGTATTGAAGACTGTCCGATGATGGTCGATAATAAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTCTCAAACCCATGTCTTTTTTTTTTAGGGCACGGGCTTTGGAATTGGGGGCTGCTGGCGGTGAAAAGCTGTCAGCTCTCCTGAAATGCATTAGCAAAGGACGGCAAGTCTTTGACGTGCACGGCCTTCGACGTGATAATGATCGTCGTGGCTGGAGCGTCGGACATGCATGAATCGTCTGTGCTGCTTCTAATTTCCTAGGCTAGCCTTGGGTTGGTCACTTAGCTACTAGTCGGTCATGAGGCTGATGAACGTTGAGCAGGCCGAGCTAGGCTAATGTCTCTATTCGAAAC

Clarification
By: I. G. Safonov (IGSafonov)
2017-01-18 12:16:03 CST (-0500)

Was not aware when the name would be published. Must have published today as it wasn’t there yesterday. The copyright was temporary till the name would appear officially on IF/SF. In this day and age one has to be careful about protecting one’s interests. The sequences will be posted here shortly.

Valid publication and copyright
By: S. Redhead (Scott)
2017-01-18 11:33:15 CST (-0500)

This name now appears to be validly published Butyriboletus taughannockensis Safonov, sp.nov. IF552747 at http://www.indexfungorum.org/...
as of today (Jan. 18, 2017)

The IF publication refers to this MO number 250839 for more details. Here on MO I notice the copyright declaration. Can anyone tell me if the copyright declaration contradicts any agreement by participants to use MO? I draw your attention to these developments as a new twist on publications. The type is in the author’s private herbarium and I saw no reference to deposited DNA sequences.

That’s a whole lot of fantastic
By: Judi T. (AvidAmateur)
2017-01-09 10:21:51 CST (-0500)

work there, Igor. Very thorough.

Updated
By: I. G. Safonov (IGSafonov)
2016-09-19 16:05:30 CDT (-0400)

Full description and spore pix posted.

Some of what I IDed as B. brunneus…
By: Dave W (Dave W)
2016-09-17 23:05:58 CDT (-0400)

earlier this summer had stipes with faint reticulatum and showed very little bluing, eg. obs 241296.
But if these are B. brunneus, then they represent serious outliers within this species concept. Lack of red on the stipe base is out of place for brunneus.

Created: 2016-09-03 19:47:12 CDT (-0400)
Last modified: 2017-03-11 15:10:48 CST (-0500)
Viewed: 409 times, last viewed: 2017-04-25 12:10:10 CDT (-0400)
Show Log