Observation 255258: Boletaceae Chevall.
When: 2016-10-05
No herbarium specimen

Notes: collected for IGS

KOH orange on context but nothing much on pileus

Proposed Names

-28% (3)
Eye3
Used references: 1) North American Fungi 12 (2): 1-8 (2016)
2) obs 243202
60% (2)
Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No! Safonovoporus!
By: Geoff Balme (geoff balme)
2017-03-22 06:02:18 PDT (-0700)

You answered some questions there — when I was earlier bugging you about “outgroup” I was searching for what score would be considered “low percentage” of matching. I’m really surprised it’s still such a high percentage.

LSU sequencing results and discussion
By: I. G. Safonov (IGSafonov)
2017-03-20 12:09:01 PDT (-0700)

> A clean and contiguous sequence consisting of the last 272 nucleotides of nrITS (the later part of the 5.8S region and the entire ITS2 region) and the first 963 characters of nrLSU (up to the LR5 region) had been procured for this material and posted in the comment below.
> A GenBank BLAST search of the nrLSU sequence did not return any meaningful results as to the possible generic placement of this bolete within the Boletaceae.
To begin with, there are no close matches. As a matter of fact, the highest observed similarity doesn’t exceed 96.5% for the top hit – the familiar Neoboletus sp. ‘vividivelutinus’, a red-pored bolete with a smooth stipe originating from western USA and closely resembling the European Sutorius luridiformis. The second and third hits are both species of Rubroboletus; the fourth hit is Gymnogaster boletoides(!), an exotic secotioid bolete reported from Australia. As one can see right off the bat, the hit list lacks any structure/clustering pointing to any genus in particular, and the gestalt morphology of 255258 is not a good fit with the generic diagnoses of Rubroboletus or Neoboletus/Sutorius.
To summarize the gross picture painted by the BLAST search, the first 40 hits with identities in the 95.5-96.5% range come from a wide array of genera from different corners of the Boletaceae. The vast majority of these hits, however, are part of the ‘Pulveroboletus Group’, a ‘dust bin’ created by Wu et al. (2014) to accommodate boletes that couldn’t be confidently placed into any of the 6 aptly-erected subfamilies, suggesting that 255258 could well be a ‘dust bin’ resident for the time being. While many of the genera within this eclectic conglomeration are solid monophyletic clades, evolutionary relationships between these and the genera confidently placed into the subfamilies have not yet been satisfactorily resolved. The low BLAST % similarity score and the observed morphology suggest 255258 could represent a unique lineage, perhaps deserving a separate genus. [If so, I would propose Balmeria. :-)]
> A separate BLAST comparison with published LSU sequences of Alessioporus rubriflavus vouchers (GB accession #KT223009 = holotype and #KC812306) revealed that 255258 was only 95.0% similar.
> Yet another BLAST search of the partial nrITS sequence mirrored the message from nrLSU – no close hits and no meaningful affinities. The closest match was… Boletus pallidus at ~97%! Strange bedfellows!

Well.
By: Geoff Balme (geoff balme)
2017-03-20 09:35:06 PDT (-0700)

Perhaps that other sequence will shed some light. I did feel like this was a different mushroom, but I am always astonished to be finding material that is so tricky to put names on.

Thanks for your efforts, Igor!

Geoff,
By: I. G. Safonov (IGSafonov)
2017-03-20 08:43:46 PDT (-0700)

There are no matches for either sequence. I appears your fancy bolete shows no particular allegiance to any specific genus or even subfamily. It loosely fits into the ‘Pulveroboletus Group’, which makes sense, but that’s just one locus telling a story. I am also sequencing TEF-1 for this collection, but it may take awhile for the data to arrive. Still, I think it will probably wind up in a new genus. You can BLAST the nrLSU on your own to see what I mean, but I will post my write-up anyway later today.

I’ll be very curious
By: Geoff Balme (geoff balme)
2017-03-20 04:40:12 PDT (-0700)

what you get for matches! If i can ever get Paup* running again (the old macbook I had an old copy on has been very fussy) maybe I can paste these sequences in and do some trees.

DNA sequencing results and discussion (preliminary)
By: I. G. Safonov (IGSafonov)
2017-03-19 18:22:22 PDT (-0700)

In short, DNA says it’s not Alessioporus rubriflavus and not ‘Neoboletus pseudosulphureus’. A full-blown discussion of results will be posted later.

nrITS (partial) —> nrLSU sequence MO255258
By: I. G. Safonov (IGSafonov)
2017-03-19 18:16:38 PDT (-0700)

5.8S end with variations: CATGCCTGTTTGAGTGTCATTAA <==ITS2
LSU rDNA Begin: TTGACCTCAAATCA 28S rDNA “LSU” ==>

GAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAG CATGCCTGTTTGAGTGTCATTGA ATTCTCAACCATGTCTTGATTGACATTGGCTTGGAGTTGGGGGTCTGCTGGCGGCGAAGGCTGTCAGCTCTCCTGAAATGCATTAGCAAAAAGCCAAGTGGGTATGGCCTTGGACGTGATAATTAATTGATCGTCATGGGCTGGATGCATTTGGTTGTCTAC TTGACCTCAAATCA GGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTTGAATCTGGCGGTCTTTGACCGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGTGCTGGACCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTACTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGTGTCGACCRGGGATCAACCTTGCTTCATCGCTCGGTGTACTTCCCGGTAGACAGGTCAGCGTCGGTTTCTGTCGCCGTACAAGGGCAAAGGGAATGTGGCACTCTTTGGGGTGTGTTATAGCCTTTCGTCGCATGCGGTGGTCGGGACTGAGGAACTCAGCACGACTTCGGTTTGTTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGCAAACTCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATTGACGCCCGGACCTGAGTCTTTGACGAGGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGC

It’ll be interesting to see
By: Geoff Balme (geoff balme)
2017-03-02 14:41:25 PST (-0800)

where the molecules lay it. Thank you for your thoughtful reply, Igor. By the way the paper is Feb 28th 2017! :) Not yet a week old.

Geoff,
By: I. G. Safonov (IGSafonov)
2017-03-02 14:22:16 PST (-0800)

I am sequencing this one, too, but not the nrITS locus. In their Alessioporus rubriflavus paper, Frank et al. give GB accession numbers for both nrITS and nrLSU sequences obtained from all the vouchers they examined. So, it would be possible to compare the sequences when molecular data for your collection becomes available soon – all we need to know if the sequences are a match or not. Now, one still needs to be careful with interpreting nrLSU data – two or more taxa may have identical sequences, as exemplified by my recent experience with red-pored boletes. (this paragraph edited on 20-Mar-17)
As far as the identity of your bolete is concerned, it may not be either of the two current proposals. First, I am doubtful the European “pseudosulphureus” exists in the USA. Second, if it does and if my understanding of taxonomy and nomenclature is correct, this species should now be called Sutorius luridiformis var. pseudosulphureus (this is not in Index Fungorum yet, but that’s what the literature suggests). I proposed A. rubriflavus for this obsie and obs 243202 on a hunch after reading the Frank et al. paper and examining their photos of two voucher collections. While I am hesitant about this collection, I am almost convinced that 243202 is indeed A. rubriflavus.
The cap colors and texture of this species, and how they change as a function of age, are very distinct and extremely useful for identification. The authors write:

surface… appressed-tomentose to fasiculate-tomentose, older specimens becoming rimose-areolate and fasciculate, dark wine-red on very young buttons, soon developing a yellow ground color covered with streaks and splashes of various shades of wine-red, red-brown and ocher, sometimes retaining wine-red coloration well into maturity, becoming olive to brownish olive over the disc in age, staining greenish blue to bluish black when bruised or handled.”

According to the latest and greatest in bolete phylogeny, Alessioporus is sandwiched between Aureoboletus and Hemileccinum in the subfamily Xerocomoideae, but statistical support (bootstrap values and posterior probabilities) is currently lacking for this placement (Wu et al. 2016). While macro-morphology is no longer a great predictor of relatedness and taxonomic relationships, with the genetic data aside, I would have placed rubriflavus into the ‘Pulveroboletus Group’.

I know this is tricky to say
By: Geoff Balme (geoff balme)
2017-03-02 05:55:21 PST (-0800)

But this mushroom really struck me as unusual – I don’t remember seeing anything else quite like it. It had an almost waxy cap like feel, and definitely had unusual red-streaking (unlike the usual brownish-red of many boletes).

Created: 2016-10-05 13:34:42 PDT (-0700)
Last modified: 2017-03-20 14:25:35 PDT (-0700)
Viewed: 160 times, last viewed: 2017-03-24 20:40:20 PDT (-0700)
Show Log