Observation 255258: Boletaceae Chevall.
When: 2016-10-05
No herbarium specimen

Notes: collected for IGS

KOH orange on context but nothing much on pileus

Proposed Names

-28% (3)
Eye3
Used references: 1) North American Fungi 12 (2): 1-8 (2016)
2) obs 243202
60% (2)
Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
I’m definitely
By: Geoff Balme (geoff balme)
2017-05-05 18:17:34 CDT (-0500)

Not buying it. :p

New developments regarding identity
By: I. G. Safonov (IGSafonov)
2017-05-05 14:41:24 CDT (-0500)

The nrLSU trace of this collection is identical to those of:
obs 249345 (Dave W, PA)
obs 255923 (Geoff’s)
obs 256721 (Geoff’s)

In addition to this evidence, the available ITS fragment of this collection (255258) of 272 bps was identical to the corresponding region in the ITS of Dave W’s 249345.
The data thus suggest the 4 collections are conspecific. The remarkably variable appearance related to age, exposure of the elements and other factors affecting the gross morphology can be appreciated from the pix in these observations.

Hey I actually do have a copy of that
By: Geoff Balme (geoff balme)
2017-04-11 11:48:21 CDT (-0500)

I didn’t even think of checking in it. The Coker and Beers book doesn’t have a species match for this. Nor Smith and Theirs nor Snell and Dick. If that’s any help.

I’m looking forward to this season and will probably be moving around a bit as time permits. I may actually be getting a job one of these days!!

being a mushrooming bum doesn’t pay much! :p

Don’t get me wrong, Geoff
By: I. G. Safonov (IGSafonov)
2017-04-11 11:05:26 CDT (-0500)

I didn’t mean you should leave Umstead for different pastures, but merely suggesting that a change in habitat/geographical area may translate into more cryptic critters.
Umstead S.P. is surely a gem in all regards, including its spectacular selection of fleshy pored mushrooms – known and unknown – you’ve been scrupulously documenting on MO. I would love to visit the place myself one day to experience its grandeur and mycoflora. Moreover, the park is very close to the general area where Coker & Beers collected before publishing their The Boletaceae of North Carolina in 1943. I don’t own a copy of this ‘regional monograph’, but I cannot help wondering if some your mysterious bolete collections have actually been documented there. Indeed, I think one of the challenges of contemporary bolete identification is not so much in recognizing a novel taxon from morphology or via DNA, but in convincing oneself that it hasn’t been described before and buried in some old, forgotten literature.

The park I use so much : Umstead State Park
By: Geoff Balme (geoff balme)
2017-04-11 08:57:20 CDT (-0500)

Is kind of unique in having been founded long enough ago (1930s) that it is loaded with a nice variety of mature hardwoods and pines.
It is also quite nearby and very accommodating – Also they’re very interested in what I’m doing.

I have plans this summer to hit some Appalachian areas as I’ve been invited by friends to visit their properties out there.

I do however enjoy the idea of as thoroughly as possible getting to know a small area and cataloging everything there. I am quite astonished that so much unusual stuff can come up in such a remarkably small preserve.

More unusual boletes…
By: I. G. Safonov (IGSafonov)
2017-04-11 08:34:26 CDT (-0500)

…to follow from NC this summer, no doubt, especially if you start visiting other local parks. After collecting and posting so many curious collection last year, expect nothing less from you this season, Geoff. :-) More sequences from your 2016 bolete treasure trove will follow in due time — stay tuned!

“Safonovoporus” is an unusual critter!
By: Geoff Balme (geoff balme)
2017-04-11 07:38:46 CDT (-0500)

but there are many mushrooms I’ve never personally encountered and just assumed it’d be in my books somewhere.

Who knew some casual observation would turn up so much unusual material!?
Maybe everyone but me knew that! :p

TEF-1-alpha sequence + brief discussion
By: I. G. Safonov (IGSafonov)
2017-04-10 20:11:16 CDT (-0500)

> TEF-1-alpha sequence MO255258/Boletaceae:
GCCCCCGGACACCGTGATTTTATCAAAAACATGATCACTGGTACCTCCCAGGCTGACTGTGCCATCCTCATTATCGCCGGTGGTACCGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGTCAGACCCGTGAACACGCTCTTCTGGCGTTCACCCTCGGTGTGCGTCAGCTCATTGTCGCTGTAAATAAGATGGACACAACCAAGGTGCGTTATACACTTTCTCCGGATGAACGTGGTTTGATATGTTACCAATAGTGGAGCGAGGACCGCTTTAACGAAATTATCAAGGAAACCTCGACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTCGCTTTCGTGCCTATCTCTGGCTGGCATGGTGACAACATGCTGGAGGAGTCCCCCAAGTAAGTATCATTTTATCAGATTGACCTTCAGCATTCTCAAAGCATCGAAATAGCATGCCCTGGTACAAGGGCTGGACCAAGGAGGTCAAGGGTGGTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATCGATGCCATCGAGCCTCCTGTCCGTCCCTCTGACAAACCCCTTCGCCTTCCTCTCCAGGATGTCTACAAGATCGGTGGTATTGGAACAGT

No matching or even close hits in GenBank. Highest similarity is less than 95% with a number of Retiboletus vouchers. Now, that’s telling! Very, very unique bolete, Geoff! All bets are off!

No! Safonovoporus!
By: Geoff Balme (geoff balme)
2017-03-22 08:02:18 CDT (-0500)

You answered some questions there — when I was earlier bugging you about “outgroup” I was searching for what score would be considered “low percentage” of matching. I’m really surprised it’s still such a high percentage.

LSU sequencing results and discussion
By: I. G. Safonov (IGSafonov)
2017-03-20 14:09:01 CDT (-0500)

> A clean and contiguous sequence consisting of the last 272 nucleotides of nrITS (the later part of the 5.8S region and the entire ITS2 region) and the first 963 characters of nrLSU (up to the LR5 region) had been procured for this material and posted in the comment below.
> A GenBank BLAST search of the nrLSU sequence did not return any meaningful results as to the possible generic placement of this bolete within the Boletaceae.
To begin with, there are no close matches. As a matter of fact, the highest observed similarity doesn’t exceed 96.5% for the top hit – the familiar Neoboletus sp. ‘vividivelutinus’, a red-pored bolete with a smooth stipe originating from western USA and closely resembling the European Sutorius luridiformis. The second and third hits are both species of Rubroboletus; the fourth hit is Gymnogaster boletoides(!), an exotic secotioid bolete reported from Australia. As one can see right off the bat, the hit list lacks any structure/clustering pointing to any genus in particular, and the gestalt morphology of 255258 is not a good fit with the generic diagnoses of Rubroboletus or Neoboletus/Sutorius.
To summarize the gross picture painted by the BLAST search, the first 40 hits with identities in the 95.5-96.5% range come from a wide array of genera from different corners of the Boletaceae. The vast majority of these hits, however, are part of the ‘Pulveroboletus Group’, a ‘dust bin’ created by Wu et al. (2014) to accommodate boletes that couldn’t be confidently placed into any of the 6 aptly-erected subfamilies, suggesting that 255258 could well be a ‘dust bin’ resident for the time being. While many of the genera within this eclectic conglomeration are solid monophyletic clades, evolutionary relationships between these and the genera confidently placed into the subfamilies have not yet been satisfactorily resolved. The low BLAST % similarity score and the observed morphology suggest 255258 could represent a unique lineage, perhaps deserving a separate genus. [If so, I would propose Balmeria. :-)]
> A separate BLAST comparison with published LSU sequences of Alessioporus rubriflavus vouchers (GB accession #KT223009 = holotype and #KC812306) revealed that 255258 was only 95.0% similar.
> Yet another BLAST search of the partial nrITS sequence mirrored the message from nrLSU – no close hits and no meaningful affinities. The closest match was… Boletus pallidus at ~97%! Strange bedfellows!

Well.
By: Geoff Balme (geoff balme)
2017-03-20 11:35:06 CDT (-0500)

Perhaps that other sequence will shed some light. I did feel like this was a different mushroom, but I am always astonished to be finding material that is so tricky to put names on.

Thanks for your efforts, Igor!

Geoff,
By: I. G. Safonov (IGSafonov)
2017-03-20 10:43:46 CDT (-0500)

There are no matches for either sequence. I appears your fancy bolete shows no particular allegiance to any specific genus or even subfamily. It loosely fits into the ‘Pulveroboletus Group’, which makes sense, but that’s just one locus telling a story. I am also sequencing TEF-1 for this collection, but it may take awhile for the data to arrive. Still, I think it will probably wind up in a new genus. You can BLAST the nrLSU on your own to see what I mean, but I will post my write-up anyway later today.

I’ll be very curious
By: Geoff Balme (geoff balme)
2017-03-20 06:40:12 CDT (-0500)

what you get for matches! If i can ever get Paup* running again (the old macbook I had an old copy on has been very fussy) maybe I can paste these sequences in and do some trees.

DNA sequencing results and discussion (preliminary)
By: I. G. Safonov (IGSafonov)
2017-03-19 20:22:22 CDT (-0500)

In short, DNA says it’s not Alessioporus rubriflavus and not ‘Neoboletus pseudosulphureus’. A full-blown discussion of results will be posted later.

nrITS (partial) + nrLSU sequences MO255258
By: I. G. Safonov (IGSafonov)
2017-03-19 20:16:38 CDT (-0500)

> nrITS sequence MO255258/Boletaceae (partial 5.8S + entire ITS2 region):
GAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTGAATTCTCAACCATGTCTTGATTGACATTGGCTTGGAGTTGGGGGTCTGCTGGCGGCGAAGGCTGTCAGCTCTCCTGAAATGCATTAGCAAAAAGCCAAGTGGGTATGGCCTTGGACGTGATAATTAATTGATCGTCATGGGCTGGATGCATTTGGTTGTCTAC

> nrLSU sequence MO255258/Boletaceae:
TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTTGAATCTGGCGGTCTTTGACCGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGTGCTGGACCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTACTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGTGTCGACCRGGGATCAACCTTGCTTCATCGCTCGGTGTACTTCCCGGTAGACAGGTCAGCGTCGGTTTCTGTCGCCGTACAAGGGCAAAGGGAATGTGGCACTCTTTGGGGTGTGTTATAGCCTTTCGTCGCATGCGGTGGTCGGGACTGAGGAACTCAGCACGACTTCGGTTTGTTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGCAAACTCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATTGACGCCCGGACCTGAGTCTTTGACGAGGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGC

It’ll be interesting to see
By: Geoff Balme (geoff balme)
2017-03-02 16:41:25 CST (-0600)

where the molecules lay it. Thank you for your thoughtful reply, Igor. By the way the paper is Feb 28th 2017! :) Not yet a week old.

Geoff,
By: I. G. Safonov (IGSafonov)
2017-03-02 16:22:16 CST (-0600)

I am sequencing this one, too, but not the nrITS locus. In their Alessioporus rubriflavus paper, Frank et al. give GB accession numbers for both nrITS and nrLSU sequences obtained from all the vouchers they examined. So, it would be possible to compare the sequences when molecular data for your collection becomes available soon – all we need to know if the sequences are a match or not. Now, one still needs to be careful with interpreting nrLSU data – two or more taxa may have identical sequences, as exemplified by my recent experience with red-pored boletes. (this paragraph edited on 20-Mar-17)
As far as the identity of your bolete is concerned, it may not be either of the two current proposals. First, I am doubtful the European “pseudosulphureus” exists in the USA. Second, if it does and if my understanding of taxonomy and nomenclature is correct, this species should now be called Sutorius luridiformis var. pseudosulphureus (this is not in Index Fungorum yet, but that’s what the literature suggests). I proposed A. rubriflavus for this obsie and obs 243202 on a hunch after reading the Frank et al. paper and examining their photos of two voucher collections. While I am hesitant about this collection, I am almost convinced that 243202 is indeed A. rubriflavus.
The cap colors and texture of this species, and how they change as a function of age, are very distinct and extremely useful for identification. The authors write:

surface… appressed-tomentose to fasiculate-tomentose, older specimens becoming rimose-areolate and fasciculate, dark wine-red on very young buttons, soon developing a yellow ground color covered with streaks and splashes of various shades of wine-red, red-brown and ocher, sometimes retaining wine-red coloration well into maturity, becoming olive to brownish olive over the disc in age, staining greenish blue to bluish black when bruised or handled.”

According to the latest and greatest in bolete phylogeny, Alessioporus is sandwiched between Aureoboletus and Hemileccinum in the subfamily Xerocomoideae, but statistical support (bootstrap values and posterior probabilities) is currently lacking for this placement (Wu et al. 2016). While macro-morphology is no longer a great predictor of relatedness and taxonomic relationships, with the genetic data aside, I would have placed rubriflavus into the ‘Pulveroboletus Group’.

I know this is tricky to say
By: Geoff Balme (geoff balme)
2017-03-02 07:55:21 CST (-0600)

But this mushroom really struck me as unusual – I don’t remember seeing anything else quite like it. It had an almost waxy cap like feel, and definitely had unusual red-streaking (unlike the usual brownish-red of many boletes).

Created: 2016-10-05 15:34:42 CDT (-0500)
Last modified: 2017-04-11 08:05:19 CDT (-0500)
Viewed: 275 times, last viewed: 2017-05-23 18:28:18 CDT (-0500)
Show Log