Observation 274559: Morchella snyderi M. Kuo & Methven

When: 2017-04-20

Collection location: Yosemite National Park, California, USA [Click for map]

37.8242° -119.8567°

Who: Alan Rockefeller (Alan Rockefeller)

No specimen available

Notes:
Under large dead Abies concolor in an area burned by the 2013 rim fire.

Odor spermatic.

Species Lists

Images

857442
731720.jpg
Edited with Photoshop
731720
DSC_6931-2.jpg
731721
DSC_6921-2.jpg
731722
DSC_6926-2.jpg
731737
DSC_6811-tridedntina.jpg
731740
DSC_6818-tridentina-yosemite.jpg
737092
DSC_7006-2.jpg
Goes across the agar dish relatively quickly, in about 5 days. ITS sequencing was used to verify that the culture in the photo is M. snyderi.
749520
DSC_7591-2.jpg
The same petri dish 6/24/17
749521
DSC_7576-2.jpg
On rye berries and sawdust
749522
DSC_7575-2.jpg
On rye berries and sawdust
749523
DSC_7574-2.jpg
On rye berries and sawdust

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
something amiss here.
By: Debbie Viess (amanitarita)
2017-06-29 22:56:10 WIB (+0700)
GenBank MF079264
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 18:52:02 WIB (+0700)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2017-05-11 10:09:16 WIB (+0700)

TGTTGAACGTCCTGGCCGGACCCGGAGCCGCCCCCATCTAAACCCTCTGCGTACCTGTCCCTTCTTGCTTCCCCCGACATCTCGTCGGGGGGAGGGAACAACCAAAACTCTTTGTGAATCAAACAGCCGTCAGAATTATAAAACAAACAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTTGTTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTCGTTTCCCAATGTCCTAAATAAACGTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATATAGGCTTGCAGTAAAATGCTCACCTCTCTTCACACGCCGATGGCACGACAGTTGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCACAATACATAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Created: 2017-04-21 15:27:33 WIB (+0700)
Last modified: 2018-03-21 11:40:36 WIB (+0700)
Viewed: 551 times, last viewed: 2018-05-06 12:18:13 WIB (+0700)
Show Log