Observation 276161: Calvatia pachydermica (Speg.) Kreisel

Notes:
Xoe Riphenburg collection. Found in soil near the Claremont DMV.

ITS sequence: TGATGGGTTGTAGCTGGCTCTTCGGGGCATGTGCACGCCTGTCTTGATTCTATTCATCCACCTGTGCACC
TTTTGTAGTCTTGGGGTTGAAAAGCGGTCAAATATCGGACGGTTATTGTGGCTGTTCCGGATGTGAGGAT
TGCTGAGTGCGAAAGCATACAGCTTTTCTCAATGTGACTTGTAAACTCTCCCTCGAGCACTATGTTTTCA
TATACCACATAGTATGTTGTAGAATGTGATCAATGGGCCTATGTGCCTATAATAATCATATACAACTTTC
AGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG
AATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTG
AGTGTCATTAAATTCTCAACCCCTCCAGCTTTTGTGAGTTGCGATGGGGCTTGGAAGTTGGGAGTTTGCG
GGCCTTTGTA

Proposed Names

58% (1)
Eye3 Eyes3
Based on chemical features: 99% ITS match with EU833653

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF073285
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 08:12:33 CDT (-0400)

Created: 2017-05-10 01:12:18 CDT (-0400)
Last modified: 2018-02-05 06:41:58 CST (-0500)
Viewed: 49 times, last viewed: 2018-02-18 15:11:52 CST (-0500)
Show Log