Observation 276161: Calvatia pachydermica (Speg.) Kreisel

Notes:
Xoe Riphenburg collection. Found in soil near the Claremont DMV.

ITS sequence: TGATGGGTTGTAGCTGGCTCTTCGGGGCATGTGCACGCCTGTCTTGATTCTATTCATCCACCTGTGCACC
TTTTGTAGTCTTGGGGTTGAAAAGCGGTCAAATATCGGACGGTTATTGTGGCTGTTCCGGATGTGAGGAT
TGCTGAGTGCGAAAGCATACAGCTTTTCTCAATGTGACTTGTAAACTCTCCCTCGAGCACTATGTTTTCA
TATACCACATAGTATGTTGTAGAATGTGATCAATGGGCCTATGTGCCTATAATAATCATATACAACTTTC
AGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG
AATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTG
AGTGTCATTAAATTCTCAACCCCTCCAGCTTTTGTGAGTTGCGATGGGGCTTGGAAGTTGGGAGTTTGCG
GGCCTTTGTA

Proposed Names

58% (1)
Eye3 Eyes3
Based on chemical features: 99% ITS match with EU833653

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF073285
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 13:12:33 BST (+0100)

Created: 2017-05-10 06:12:18 BST (+0100)
Last modified: 2018-02-05 11:41:58 GMT (+0000)
Viewed: 55 times, last viewed: 2018-05-12 18:11:54 BST (+0100)
Show Log