Observation 276166: Pleonectria Sacc.
When: 2017-04-20
No herbarium specimen
0 Sequences

Notes:
Cultured from Morchella brunnea, http://mushroomobserver.org/274561.

Forming orange fruit bodies on agar.

ITS sequence:

AGCCCCGGCGCCTCTGTGCCCGGAATCAGGCGCCCGCCGGAGGCCCCAAACTCTTGTTTTTTAGTGATATCTTCTGAGTCTCACAAACAAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGTGTTGGGGATCGGCCGCCGTTAAACCGGTGGCCGGCCCCGAATTATAGTGGCGGTCTCGCTGTAGCCTCCTCTGCGTAGTAGCACACCTCGCACCGGAACGCAGCCTGGCCACGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Species Lists

Images

749527
DSC_7586-2.jpg
06.20.2017
736865
DSC_6987-2.jpg
736866
DSC_6991-2.jpg
736867
DSC_6992-3.jpg
736868
DSC_6992-2.jpg
749528
DSC_7589-2.jpg
400x in KOH
749529
DSC_7587-2.jpg
400x in KOH
749530
DSC_7588-2.jpg
400x in KOH

Proposed Names

58% (1)
Eye3 Eyes3
Based on chemical features: 99% ITS match with KT423109

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF085559
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 04:46:13 PDT (-0700)

Created: 2017-05-10 01:39:47 PDT (-0700)
Last modified: 2017-06-24 05:29:41 PDT (-0700)
Viewed: 63 times, last viewed: 2017-07-14 20:56:52 PDT (-0700)
Show Log