Observation 276167: Arthrinium arundinis (Corda) Dyko & B. Sutton
When: 2017-04-20
No herbarium specimen
0 Sequences

Notes:
Cultured from http://mushroomobserver.org/274559

ITS sequence:

CTCGGTTGGAGGCACCTGCAGCTACCCTGTAGTTGCGGACTGCCAACTCCAGCCGCGGCCCGCCGGCGGTACACTAAACTCTGTTTTATTTTATATTCTGAGCGTCTTATTTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATCAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTGCTGTACTGCAGTTCCTTAAAGACAGTGGCGGAGCGGCGGTAGTCCTCTGAGCGTAGTAATTTATTTCTCGCTTTTGTCAGGCTCTGTCCTCCCGCCATAAAACCCCCAATTTTTTAGTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Proposed Names

58% (1)
Eye3 Eyes3
Based on chemical features: 100% ITS match with KF144883

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF073329
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 04:43:45 PDT (-0700)

Created: 2017-05-10 02:34:44 PDT (-0700)
Last modified: 2017-05-10 02:34:51 PDT (-0700)
Viewed: 48 times, last viewed: 2017-12-04 16:56:13 PST (-0800)
Show Log