Observation 276167: Arthrinium arundinis (Corda) Dyko & B. Sutton

Notes:
Cultured from http://mushroomobserver.org/274559

ITS sequence:

CTCGGTTGGAGGCACCTGCAGCTACCCTGTAGTTGCGGACTGCCAACTCCAGCCGCGGCCCGCCGGCGGTACACTAAACTCTGTTTTATTTTATATTCTGAGCGTCTTATTTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATCAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTGCTGTACTGCAGTTCCTTAAAGACAGTGGCGGAGCGGCGGTAGTCCTCTGAGCGTAGTAATTTATTTCTCGCTTTTGTCAGGCTCTGTCCTCCCGCCATAAAACCCCCAATTTTTTAGTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Proposed Names

58% (1)
Eye3 Eyes3
Based on chemical features: 100% ITS match with KF144883

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF073329
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 04:43:45 PDT (-0700)

Created: 2017-05-10 02:34:44 PDT (-0700)
Last modified: 2017-12-31 06:16:29 PST (-0800)
Viewed: 64 times, last viewed: 2018-04-19 10:54:25 PDT (-0700)
Show Log