Observation 276178: Dothideomycetes O.E. Erikss. & Winka
When: 2017-04-20
No herbarium specimen
0 Sequences

Notes:
Cultured from Morchella snyderi, http://mushroomobserver.org/274559.

Makes lots of tiny spores on agar – cylindrical, approximately .75 × 3 micrometers. There are also some purple structures.

ITS sequence:

TTACTTTACGAGCACCTTTCGTTCTCCTTCGGCGGGGCAACCCGCCGCTGGAATCCCATCAAACCTTTTTTTGCATCTAGCATTACCTGTTCTGATAAAAAACAATCGTAACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATCTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCCCGCCTCTGCGCGCGGACTCGCCCCAAAGGCATTGGCAGCGGTCCACGGCCCCTCTCGCGCAGCACATTGCGCTTCTCGAGGCGGCCCGGCCCGCATCCACGAAGCCCACATTACCGTCTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Species Lists

Images

746978
DSC_7560-2.jpg
p2
737059
DSC_7000-2.jpg
Spores 1000x
737060
DSC_6999-2.jpg
400x
737061
DSC_6998-3.jpg
p2
737062
DSC_6998-2.jpg
p2
737063
DSC_6996-2.jpg
p1

Proposed Names

29% (1)
Eye3 Eyes3
Based on chemical features: ITS match 2 bases from KP990985
29% (1)
Eye3
Based on chemical features: ITS match 3 bases from KC963954
29% (1)
Eye3
Based on chemical features: ITS match 3 bases from JX681086
29% (1)
Eye3
Based on chemical features: ITS match 3 bases from KP325440
29% (1)
Eye3
Based on chemical features: ITS match 4 bases from KU158159
29% (1)
Eye3
Based on chemical features: ITS match 4 bases from JX496053
29% (1)
Eye3
Based on chemical features: ITS match 4 bases from KF573981

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF078677
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 13:23:35 PDT (-0700)
Cultured from …
By: James D'andí (TSD)
2017-05-11 07:45:17 PDT (-0700)

Your note indicates the culture derived from Morchella tridentina fruitbodies, but the observation linked has been identified by you via ITS as Morchella snyderi.

Media
By: Alan Rockefeller (Alan Rockefeller)
2017-05-11 07:11:50 PDT (-0700)

Might be slime mold, or maybe it’s just colorful. I’ll know for sure after a few more transfers. I’ve never had slime mold on agar before.

The media is standard MEA + ampicillin + kanamycin + green food coloring. The food coloring indicates which batch of agar it is.

It looks like photo 1 might be contaminated with a slime mold
By: Martin Livezey (MLivezey)
2017-05-11 06:07:36 PDT (-0700)

Unfortunate if true. Alan, what growing medium are you using? Potato dextrose (PDA)? Why is there dye in it?

Created: 2017-05-10 12:29:17 PDT (-0700)
Last modified: 2017-06-17 00:29:41 PDT (-0700)
Viewed: 88 times, last viewed: 2017-06-30 20:55:07 PDT (-0700)
Show Log