NEW FEATURES! Read about them here: May 7th releases and May 18th releases
Introduction
How To Use
How To Help
Donate
Feature Tracker
Send a Comment

Index A→Z
List Locations
List Projects

Latest:
 Changes by Users
 Images
 Comments
 Features and Fixes

Observations:
 Create Observation
 Sort by Date

Species Lists:
 Create List
 Sort by Date
 Sort by Title

Account:
 Login
 Create Account

Languages:
 Deutsch
 Ελληνικά
 English
 Español
 Français
 Polski
 Português
 Русский

Contributors
Site Stats
Translator’s Note

Colors from Black on White

Powered by:
Ruby on Rails
Preferred browser:
FireFox

Valid XHTML 1.0 Transitional

Observation: Agaricus agrinferus Kerrigan et Callac (7441)
About Agaricus agrinferus Kerrigan et Callac
Public Description (default) [Edit]
When: 2008-05-04
Collection location: Barton Flats, San Bernardino National Forest, San Bernardino Co., California, USA [Click for map]
Who: Nathan Wilson (nathan)
Herbarium specimen available

Notes: When I first collected these they seemed to have a slight yellow stain on the base of the stipe and a slightly unpleasant. Unfortunately, I was recovering from a cold so my sense of smell may have been off. I thought I was getting a faint version of the typical phenolic smell and another person on the trip who is familiar with the smell confirmed it. It certainly wasn’t sweet.

The pileus first stained distinctly reddish (see third image), whereas the stipe went orangish yellow at first (see fourth image), then became more reddish and finally turned brown. However, after bringing it home, and cutting open the freshest specimen it only stained red.

The habitat was mixed pine and cedar (Calocedrus decurrens) forest in the San Bernardino mountains near the Santa Ana river. The altitude was around 5700’ (1750m). A snow plant (Sarcodes sanguinea Torrey) was blooming nearby.

Proposed Names: Propose Another Name
Proposed Name User Community Vote
  nathan   29% (1)   Eye3
Recognized by sight: Definitely an Agaricus.
Used references: Nothing in Arora seems to match. Kerrigan in Agaricales of California takes me to A. spissicaulis, but based on personal communication he is no longer confident in using that European name for our California species.
  nathan   86% (1)   Eye3Eyes3
Based on chemical features: Rick Kerrigan was kind enough to do an ITS analysis of the dried material and found that it perfectly matched the newly published species Agaricus agrinferous.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice Eyes3 = Current consensus
Comments: Add Comment

Created: 2009-02-28 05:21:45 WET (+0000)
By: Darvin DeShazer (darv)
Summary: Nice

Great sequence of events!
Nice documentation to a new species.

19351

Created: 2009-02-27 04:46:50 WET (+0000)
By: Nathan Wilson (nathan)
Summary: See species page…

I quoted both the latin diagnosis and the English version on the page for Agaricus agrinferous. A full discussion is available in Mycologia, 100(6), 2008, pp. 876–892.

Interestingly the name refers to this being a ‘lowland species’. However, this particular observation was made at about 5700’ in the San Bernardino mountains under a mix of pine and cedar.

15874

Created: 2009-02-26 15:12:51 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: nice! can you link to a species description somewhere?

202406

Created: 2009-02-26 04:42:45 WET (+0000)
By: Nathan Wilson (nathan)
Summary: ITS DNA Data

Rick Kerrigan provided the following analysis:

“Your material had an ITS DNA sequence that perfectly matched that of A. agrinferous, a species we described a few months ago that used to be known as the ‘lowland’ (or coastal) entity within A. subfloccosus.

Here’s the sequence.

GGAAGGATCATTATTGAATTATGTTTTCTAGATGGGTTGTAGCTGGCTCTTCGGAGCATGTGCACACCTGTTTGGACTT
CATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTTTCAGGTATTGAAGGAAGTGGTCAGCCTATCAGCTCTTTGCTGG
ATGTAAGGACTTGCAGTGTGAAAACAGTGCTGTCCTTTACCTTGACCATGGACTCTTTTTCCTGTTAGAGTCTATGTTA
TTCATTATACTCTTAGAATGTTATTGAATGTCTTTACATGGGCTATGCCTATGAAAATTATTATACAACTTTCAGCAAC
GGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCAT
CGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTATATTCTCAACTCCC
CAATACCTTGTTGTAAAGGAGAGCTTGGATTGTGGAGGTTTGCTGGCCCCTGCTTGGGGTCAGCTCCTCTGAAATGCAT
TAGCGGAACCGTCTGCGATCTGCCACAAGTGTGATAACTTATCTACACTGGCGAGGGGATTGCTTTCTGTGATGTTCAG
CTTCTAATCGTCTAAGGACAAATTCTTGAATGCTGACCTCAAATCA
"

15874

Created: 2008-09-06 22:55:46 WEST (+0100)
By: Nathan Wilson (nathan)
Summary: More info…

I showed this observation to Rick Kerrigan at the 2008 MSA meeting, and he is no longer confident about using the name A. spissicaulis for non-European material. However, in personal communication he thinks this observation may well match what he reported as A. spissicaulis in 1982 & 1986. I have sent him the dried material (Jan. 2009), so we may know more soon.

15874

Created: 2008-05-05 14:41:48 WET (+0000)
By: Nathan Wilson (nathan)
Summary: Agaricus spissicaulis seems likely

MykoWeb mentions A. spissicaulis as occuring in California. I also just noticed the description in Agaricales. For some reason I only saw the group last night. I noticed that both Debbie’s Roger’s Mushrooms link and Index Fungorum say the name is deprecated in favor of A. littoralis (or Agaricus litoralis for the more literal minded… – looks like another r[h]ac[h]odes in the making).

15874

Created: 2008-05-05 14:23:40 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: spissicaulis?

Not familiar with this species, but did a bit of online research. The reddening fits, general stature and veil, also the “off-smell” with age (not necessarily phenolic, but perhaps phenol is a catch-all description for "bad smells in
Agaricus?). Here’s a nice description on Rogersmushrooms

202406


Created: 2008-05-05 04:52:05 WET (+0000)
Last modified: 2008-07-12 16:50:39 WEST (+0100)
Viewed: 242 times, last viewed: 2012-03-29 08:47:41 WET (+0000)