NEW FEATURES! Read about them here: May 7th releases and May 18th releases
Introduction
How To Use
How To Help
Donate
Feature Tracker
Send a Comment

Index A→Z
List Locations
List Projects

Latest:
 Changes by Users
 Images
 Comments
 Features and Fixes

Observations:
 Create Observation
 Sort by Date

Species Lists:
 Create List
 Sort by Date
 Sort by Title

Account:
 Login
 Create Account

Languages:
 Deutsch
 Ελληνικά
 English
 Español
 Français
 Polski
 Português
 Русский

Contributors
Site Stats
Translator’s Note

Colors from Black on White

Powered by:
Ruby on Rails
Preferred browser:
FireFox

Valid XHTML 1.0 Transitional

Observation: Cantharellus subalbidus Smith & Morse (87519)
About Cantharellus subalbidus Smith & Morse
Public Description (default) [Edit]
When: 2012-02-07
Collection location: near Fort Bragg, Mendocino Co., California, USA [Click for map]
Who: Ryane Snow (snowman)
No herbarium specimen
Species Lists:
Albinos, Pigment & Growth Oddities
Proposed Names: Propose Another Name
Proposed Name User Community Vote
  snowman   33% (2)   Eye3
Recognized by sight: Any help in identifying these mushrooms would be greatly appreciated. They were found on disturbed ground. No latex.
  amanitarita   55% (1)  
Recognized by sight: I have also seen these deformed forms before. Yellow hymenial surface, white context. betcha near some trees, too.
  damonbrunette   -34% (2)  
Recognized by sight
  Alan Rockefeller   84% (1)   Eyes3
Recognized by sight: Light colors
Based on chemical features: ITS1 Sequence 99% BLAST Match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice Eyes3 = Current consensus
Comments: Add Comment

Created: 2012-04-06 18:06:40 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: Right on

Blue Canoe, whoever you are, good points.

D.
71884

Created: 2012-04-06 17:19:36 WET (+0000)
By: BlueCanoe
Summary: sequence interpretation

I’m not an expert, but from what I understand, the ITS RNA is non-functional, meaning that these differences are not directly related to any expressed characteristics. They are used as an estimation of divergence time, and species that are further diverged are more likely to have differences in their functional expressed genes as well.

Using the NCBI BLAST website to compare this sequence to the sequences from the Dunham et. al (2003) Cantharellus cascadensis study:

C. subalbidus = 184/185 = 99.46%
C. cibarius var. roseocanus = 183/188 = 97.34%
C. cibarius var. cibarius = 182/193 = 94.30%
C. cascadensis = 178/187 = 95.19%
C. formosus = 154/201 = 76.62%

If that helps to interpret this result in terms of species.

139404

Created: 2012-04-06 15:21:46 WET (+0000)
By: Irene Andersson (irenea)
Summary: subalbidus

differs with one pair in this section. Who knows, maybe this particular bit is the one that causes the deformation?

205022

Created: 2012-04-06 14:51:52 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: hmmmmm…

it’s all about the interpretation.

what exactly does “match pretty well” mean? It’s the same species? It’s a closely related species?

If indeed it is 99% the same as subalbidus in this tiny piece of DNA that was compared, then does that make it the same species, no question? Or are there always questions?

Also, all of the examples of this odd form had a very similar color/ gestalt…why does just this one species of chanterelle show this extreme type of deformity and not the others?

We do often see hyper-hymenial tissue on the top of Cantharellus californicus, but this is a unique manifestation.

202406

Created: 2012-04-06 06:03:55 WET (+0000)
By: Ryane Snow (snowman)
Summary: Thank you Alan

Thanks Alan for taking the time to have this mushroom sequenced. This has been a very interesting process. Makes me want to get back in the lab.

64455

Created: 2012-04-06 03:52:02 WET (+0000)
By: Christian (Christian Schwarz)
Summary: Some viruses

or mis-expression of genes can cause similar abnormalities in plants (see fasciated Echium) for example.
My guess is something along those lines is cause hyper-hymenial growth (hypo-stipitate?).

167312

Created: 2012-04-06 01:56:19 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: and in plain english this means…?

a mutant/misshapen white chanterelle?

if so, why is this exact type of mutant form getting duplicated so often (see at least three other sightings, most here on MO)?

variety, or just a weird gene expression from the same species?

202406

Created: 2012-04-06 01:04:34 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: Ok.

This is a relatively small section of the nrITS, but it does match pretty well some of the Cantharellus subalbidus collections in GenBank.

D.
71884

Created: 2012-04-05 22:56:35 WET (+0000)
By: Alan Rockefeller (Alan Rockefeller)
Summary: ITS1 Sequence

CAGGAGACTTGTACACGGTCCAGCCTAGTCACCCCACCAAGCCAGGCCCCAACCAGGCCTCCCCACCAAGAAGACCACAC
ACACCCGTGCATCCAGTCCAATGGATGTGCGCACGGGTTGGGTTGGAAAAACCATCTCACTATACCCACAGGGGTTGATC
CTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCWCTAAATGACCAAGA

213828

Created: 2012-02-23 04:40:39 WET (+0000)
By: E. Taylor (Mulched)
Summary: any news or conclusions

Do we have any results from the lab(s) yet?


Created: 2012-02-12 04:00:00 WET (+0000)
By: Dave W (Dave W)
Summary: I think that modern techinques allow one

to have a better understanding of what they are after. But closure — as it applies to fungal species names — appears to still lie beyond the grasp.

I suppose a better way to put it — as opposed to saying that DNA methods are still in the formative stages — is to say that mushroom taxonomy at large is still evolving.

100801

Created: 2012-02-12 03:18:43 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: To Dave

Dave, ultimately we are mycologists who go and collect species that we can see. And we describe the species for those who can see them (visually). Thus morphology is very important. In fungal taxonomy, the DNA is very important technology as it allows us to evaluate a lot of objective data that we just can’t see visually. It also shows us what macro/micro characters are really important when separating species or even establishing their hereditary relationships. DNA is not in infancy at all, it is very well established and has been used for quite a while. Of course, it always gets better and better as the endless evolution of any technology. But for purposes of our work, we have to understand a species well before we can describe it. And understand them in their morphology, ecology as much a possible and even geographical distribution. All these aspects need to be taken into consideration. To me that means – good collecting, photography, morphology, genetic data, understanding = good description. So at the end there is a “new species”, not “new (DNA) species”. DNA helps greatly, but describing on the DNA data as the primary data platform is unacceptable although that there has been some discussion to allow it. I am strongly against it as we need to be able to know what we are describing. As I have mentioned on MushroomTalk many times – the DNA makes me a lot more exciting to me to grab my basket and run in the field. Now I really know what I am after…

D.
71884

Created: 2012-02-12 02:36:22 WET (+0000)
By: Dave W (Dave W)
Summary: Very good for starters…

Thank you Dimi. This gets me a lot closer to understanding how DNA data is interpreted. I realize the big-picture probability discussion is very technical. But plenty of insight may be gained when one considers your “rule of 3 or more, hopefully 5” as a first step in establishing a new (DNA) species. Your comment sheds light upon the traditional importance of having a good data base of macro characters, something that Rod has also always stressed whenever I have discussed this stuff with him. I imagine that DNA-based methodology may still be in the formative stages.

For Rayne, I would offer this suggestion. If the chantie patch is one for which there is not a lot of hunting competition, then see if a few of next year’s specimens might be earmarked to remain unharvested and see how they develop. If you spot one that looks like it exhibits some funky characteristics, then let it be and see what happens.

100801

Created: 2012-02-11 21:40:07 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: Then this…

>But if this null hypothesis is rejected, then what sort of confidence does one gain to say it’s a different species?

Then simply the “real hunt starts”. As I deal with this all the time – seeing collections with gene that are not in the public databases – the following high level analysis takes place.

1) There is no proof that just because a species Is not in the gene pools than it is new. Deep knowledge of the established literature is a must. Sequencing types may become a necessity. In the case of the chanterelles the book is not that deep, so this is much easier than in other genera.

2) If the species is a new one let’s say — how do we know that it always has that mangled form? Well, we do not, although that many famous mycologists have described such mangled collections as new species based on a single collection only. This is a crime and should never happen. We need to establish based on at least 3 good collection, molecular matches what a species looks like (my practice is minimum 3, but I prefer more and everything I’ve done so far is based on minimum 5).

3) Practical next step – try to obtain material from that other MO obs. With the similarly mangled hymenial layer and see what you get. Ryane will have to establish that this species fruits like this again.

4) If there are 3 collections with such mangled hymenial layer that are proven the same based on nrITS than one might reach a conclusion that this species has a tendency to deform its out layer. But one has to be careful to make this as a definitive feature as there might be fruitbody that do not get distorted. The wording in the description is important.

General points, there is more, but this is good for starters..

D.

71884

Created: 2012-02-11 19:36:09 WET (+0000)
By: Dave W (Dave W)
Summary: Here in eastern North America

the “Smooth Chanterelles” I gather have mature fertile surface that varies from almost completely smooth to folds that are rather gill-like. This type seems devolop very slowly over time, with the folds often changing character. Linked obs shows well-developed structures.

http://mushroomobserver.org/obs/74569

Maybe this is a different species from C. lateritius. But I don’t think so. I think that some of the Smooth Chants develop rather bizarre fertile surfaces, and that, given favorable enviro conditions, the weirdness increases as the mushroom ages.

So if you do DNA and confirm a null hypothesis that this weird (presumed) chant in this obs (87519) matches a known sequence, that looks like there is an easy conclusion to reach. But if this null hypothesis is rejected, then what sort of confidence does one gain to say it’s a different species? (Rod Tulloss has explained some of this stuff to me, but I’m still trying to get a feel for the thinking.)

100801

Created: 2012-02-11 18:40:13 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: Not a plausible scenario…

I can’t see that as a plausible scenario Irene. Such developmental distortions wouldn’t show in the nrITS, particularly because both ITS1/2 and are non-expressed. Plus if there was a distortion in that low-level part of the genes the organism wouldn’t survive as the 18.S, 5.8S, and 28S are strongly expressed in the basic polymerase.

D.

71884

Created: 2012-02-11 18:32:03 WET (+0000)
By: Irene Andersson (irenea)
Summary: What if

a distorted DNA causes this distortion? Would that make it another species, or is it something you’ll just see in a particular DNA section?

205022

Created: 2012-02-11 17:48:00 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: first we run the DNA

then we worry about the interpretation.

hey, at least we all agree that this IS a cantharellus! but maybe even that theory will get proven wrong? that’s why we are running the DNA, enit? to see just what this strange creature is most closely related to?

step by step, we get a bit closer to the truth. I can wait a bit for more concrete results, and eschew further speculation.

202406

Created: 2012-02-11 17:00:14 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: A minor problem

One minor problem that we’ll run into is knowing what exactly is “Cantharellus formosus” – I see 3 different nrITS sequences on GenBank that cannot possibly be the same species. We have to determine, which one is the most trusted, or, like I do – go and collect some material myself that I am taxonomically sure of (which is not so easy) and then compare.

But, for this particular enquiry, what is important to see is whether this gene data matches a Cantharellus that appears without these strange surface deformations/growths. Then we will know that it is an environmental/developmental cause.

D.

71884

Created: 2012-02-11 16:16:49 WET (+0000)
By: Jonathan M
Summary: i can’t wait to see the result for this odd chanterelle!

204512

Created: 2012-02-11 15:59:31 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: it takes a community…

nice job, everyone.

202406

Created: 2012-02-11 05:26:41 WET (+0000)
By: Alan Rockefeller (Alan Rockefeller)
Summary: DNA

> how much would ~500 Bolivian specimens run me?

I don’t think the lab I work in can handle that kind of volume, but its possible you could work something out. I will ask on Monday, but I expect the answer to be no. The chemicals cost about $10 per specimen. Its not the kind of place that you can pay them to sequence stuff – Its more like I volunteer my time there doing lab work and in exchange they teach me all I want to know about chemistry, DNA, genetics, etc, If there are an odd number of samples in one of the runs they occasionally let me slip a couple of my collections in to fill up all of the wells in the sequencing run. If you send me some small bits of your most interesting collections I might be able to do a few.

If you want to pay to sequence stuff talk to Mike Davis, he might be able to help or know who can do it. There are a lot of labs that you can pay to sequence stuff, but you can’t just send them mushrooms as far as I know. You send them a PCR product. The DNA extraction step has some caveats so it should be done by someone familiar with how to best choose which part of the mushroom is likely to generate a clean sequence. Its not rocket science, but its generally not what these biotech companies do. This is why I want to see how difficult it would be for the average mushroom hunter to use the OpenPCR kit at home to generate a PCR product.

Perhaps you can get a grant to sequence your 500 collections or find a researcher in a lab who would like to publish something on the phylogeny of mushrooms in Bolivia.

> I sent Alan some samples of this mushroom today so we may have a sequence next week. Thank you Alan. You the man!

Great! I spoke with the people at the lab today about your sample and they are very interested to see how the sequence will turn out.

213828

Created: 2012-02-11 05:22:29 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: Let me know

Alan, let me know if you, or any of your associates/acquaintances plan to be employable in this capacity. I have a lot of work for you/them.

D.

71884

Created: 2012-02-11 03:39:00 WET (+0000)
By: Ryane Snow (snowman)
Summary: may have an answer soon

I sent Alan some samples of this mushroom today so we may have a sequence next week. Thank you Alan. You the man!

64455

Created: 2012-02-11 00:50:39 WET (+0000)
By: Danny Newman (myxomop)
Summary: Alan

how much would ~500 Bolivian specimens run me?

43847

Created: 2012-02-10 16:38:35 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: Excellent

> A PCR machine costs $20k new

There are actually cheaper new products in the 16 well grade. There are also good sources for used equipment, which are much cheaper. Of course, maintenance and warranty is a question, but I wasn’t planning to spend anywhere near $20K.

> …results will be here soon.

You’re the man of the hour!

D.

71884

Created: 2012-02-10 08:45:09 WET (+0000)
By: Alan Rockefeller (Alan Rockefeller)
Summary: DNA work

> I am very impressed!!

Well you shouldn’t be impressed yet, I haven’t actually done anything. Its all just talk at this point. Today I found a source for ITS1 primers and I also contacted the OpenPCR people asking if I can borrow a machine for a few months in exchange for publishing info on how to sequence mushrooms at home.

> I almost turned my house into a lab in 2009 and even bought a PCR machine…

There isn’t really a need for a lab, all the stuff would fit in a drawer or 2. There isn’t anything I do in the lab that I couldn’t do at home for free or very little cost, except the actual sequencing.

The first step is the bead beater. I could do that with a sterilized nail. I think the electrophoresis gel could maybe just use regular chinese grocery store agar and a homebuilt 100vdc power supply. Or I could skip that step and risk losing $8.

The pipettes are kind of expensive, but I could use a lab pipette to make a ruler to mark pipette tips so I can accurately transfer a bit of liquid for almost free. There are also many disposable pipette options on ebay for under $10.

A PCR machine costs $20k new, but all it does is heat and cool your sample according to a program. I could build a device to do that with a peltier junction from a broken minifridge and an arduino. But I’ll try to use the OpenPCR stuff, its exactly what I am looking for and very cheap. Do you still have your PCR machine? There is a DIY biotech hacker space in Mountain View which has a PCR and lots of other stuff.

> The sequencing for a small charge is super and several places do it now

Which place is best? My friends use Macrogen Inc., in Korea and the Netherlands.

> I am preparing dessicata and will mail samples off to Alan tomorrow.

Address sent, results will be here soon. I am expecting it to match C. formosus. And trying to avoid confirmation bias.

213828

Created: 2012-02-10 06:59:45 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: Great news Alan

This is great news Alan. I am very impressed!! I almost turned my house into a lab in 2009 and even bought a PCR machine… It is just that the process is a bit laborious and tedious, but I agree that the independence gained is very important. The sequencing for a small charge is super and several places do it now, otherwise a machine is beyound the capacity of a single person.

Noah, thank you for these spectacular photos.

D.
71884

Created: 2012-02-10 04:30:32 WET (+0000)
By: Ryane Snow (snowman)
Summary: Thanks to all

I am preparing dessicata and will mail samples off to Alan tomorrow. I wish to thank all of you for contributing your thoughts and knowledge in helping to elucidate the identity of this interesting fungal form. What a great community!

64455

Created: 2012-02-10 02:47:14 WET (+0000)
By: Alan Rockefeller (Alan Rockefeller)
Summary: DNA work

I ran some gels in a DNA lab today, and I am going back tomorrow to do DNA extractions. If someone can get this sample to SF by noon or Berkeley by 4pm I will sequence it right away and have results in a few days. If that is too soon or too far to drive you can mail me some and I’ll do it next week. The lab I use doesn’t charge money, it just takes time and a whole lot of pipetting. We switched to sodium hydroxide extractions recently, which saves lots of money, time and pipetting, and gives better end results.

I am starting work on a project that will allow people to do the DNA extraction and PCR amplification at home for under $1000. Sequencers are the expensive part, so you would send the PCR product off to a lab and have them sequence it for about $8 per sample. It will be based on the OpenPCR kit – You can build it in an evening and it costs $512 and has 16 wells. The labs use $20,000 PCR machines with 96 wells. But 16 wells is perfect for some evening work after a day of mushroom hunting.

213828

Created: 2012-02-10 02:19:36 WET (+0000)
By: Noah Siegel (Amanita virosa)
Summary: And the “Flower Chanterelle”

This form shows up every once in a while, there are a few observations of it on MO, (the two from the NAMA foray are part of this collection).

89114

Created: 2012-02-10 02:02:45 WET (+0000)
By: Noah Siegel (Amanita virosa)
Summary: Here are a couple of pictures

of mutant Hydnum repandum

89114

Created: 2012-02-10 00:48:22 WET (+0000)
By: E. Taylor (Mulched)
Summary: weather induced morphing?

It seems that these oddities are occuring kind of late in the season ( at least in Mendo ) when the “white” and “yellow chanterells” ( pardon my laccus botanicus, you may wanna cross reference ) are pretty much done. Could it be that weird weather patterns are “tricking” the mycillium into an autumnal relapse causing an extended or “re-bloom” before it had rested. Maybe it’s just “cranky”.


Created: 2012-02-10 00:35:23 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: I agree Dimitar, that this is probably environmental…

or individual variation within a species, but we won’t know for sure w/out looking deeper.

I am glad that you took the bait. That gentle goad was meant for you, the one person among us in the amateur world who has a direct line to sequencing, and does it often! ;)

Field observation is of course the first step, but now we need to go a bit further to solve our mystery. I have seen three (including this one); you have seen___, and Blue Canoe and Mr. Taylor have seen one. Anybody else out there seen these things?

Obviously, it is not a common phenomenon/species, but it does appear on a regular basis.

Out-sourcing, huh? Well, maybe that’ll drop the price per sample even more!

Heck, maybe ya can get a two-fer price!

Set aside the ego issues Sir, we are all playing on the same team here. ’Tis unseemly.

202406

Created: 2012-02-09 22:46:05 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: Save me a piece

Ryane, whatever you decide to do, save me a piece. I have 2-3 interesting chanterelles collections that I plan to off-shore for dna work. I may still get it faster than anyone else

My prediction is that this is an environmental/developmental factor, not a species trait. From what I can see these phenomena are pretty common, but isolated.

Having said that, still, observation is key – there is a particular Russula under oaks that I observed over a period of 3 years that has very mangled and anastomosing gills. This was a consistent feature that starts even before full maturity. That Russula is a separate species and all collections that I have seen exhibit that trait.

D.

71884

Created: 2012-02-09 17:26:57 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: give it up, Dimitar.

we get it.

we get you, too.

202406

Created: 2012-02-09 17:22:06 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: The concept of labor

>Then you just have to get someone to do the work, right?

Yahhh, right. “someone to do the work” – “labor” — what a lovely and simple concept in a lab where everybody has various competing priorities. One would wonder, why do labs need funding to do these things at all?

But since you Debbie suggested in straight text that you can do it, then why not do it? We will love you forever. Unless you made an exaggerated/misleading/deceitful claim below.

D.

P.S. The actual “labor” is a bit tedious with a lot of chances to screw things up, so an experience lab hand can have a success ration 10:1 against a beginner. There are also some toxic materials and expensive equipment to be handled. It boils down to training too. Someone like Ryane who has a background in that area can certainly do it. But in truth, it all boils down to finding someone who has the incentive to help you – either the collection has to be well substantiated as a very interesting one, or there should be other reasons.

71884

Created: 2012-02-09 16:58:14 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: silly boy.

Materials to do the DNA cost $10. Then you just have to get someone to do the work, right? DNA labs are not my thing, but that doesn’t mean that I am not aware of the process or can’t see the usefulness.

It is why I suggested it for this curious form.

202406

Created: 2012-02-09 16:55:00 WET (+0000)
By: BlueCanoe
Summary: similar C. formosus in WA

I found a similar, although less extreme, specimen in western WA last fall (image 179323). Over the course of five trips collecting for the table in the same area, examining probably 500-1000 individual caps, this was the only example of the “all hymenium” type. The only chanterelle species I found on those trips was C. formosus, making me confident that the malformed specimen was also formosus. It was consumed.

139404

Created: 2012-02-09 16:47:06 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: …but I’m not gonna do it?!?

>DNA would be useful in this instance, but I’m not gonna do it.

Oh, but please do it, why not? We beg you to do it… You project authority, like you’ve done it many times before — Debbie, I love your sense of humor… (if it was meant that way).

++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++

Now on the serious side – I told Ryane that if he gives me the collection I might find a way to get some genes, but not very soon (6-8 months) as the pipeline is full. But my best suggestion is – be sure that this is a stable form even worth sequencing. I sequence a small fraction of my collections only after I am sure that it is worth it because the process is still a bit on the expensive side in terms of resources involved.

If this is a well-documented form then I’d contact all of the local labs – make sure you give them only part of the collection – play it safe – they may promise work done, but not manage to do it. Have several options, this is the safe strategy.

D.

71884

Created: 2012-02-09 15:50:29 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: right.

we weren’t trying to get species here, just confirm genus. Ryane’s microscopy did that job just fine. We see a lot of strange, misplaced hymenium in chanterelles, one of those species that often shows hymenium on the top of the cap. this is just a more extreme example, most likely.

I have seen this form now three times (the first time collected by Richard Lyons at Salt Point), and it would indeed be interesting to see if it is just an odd morph of a well-known species, or something completely different.

DNA would be useful in this instance, but I’m not gonna do it.

Anybody else out there have a line on a DNA lab?

202406

Created: 2012-02-09 06:48:16 WET (+0000)
By: Dimitar Bojantchev (dimitar)
Summary: They get that way sometimes

I have a coupe of collections of chanterelles that got that weird – if we can observe that feature repeatedly even in younger material then I think it would be worth getting the molecules and comparing against the standard Cantharellus formosus.

The chanterelles are particularly unyielding as far as microscopy is concerned when differentiating to species level – there is almost nothing to help you. Macro characters would be more helpful. . But I agree with Noah that doing basic microscopy if always a good thing, particularly if we are uncertain o the genus even.

71884

Created: 2012-02-09 03:27:34 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: why not?

you first.

202406

Created: 2012-02-09 03:08:06 WET (+0000)
By: E. Taylor (Mulched)
Summary: Can we eat it?

I’m the guy who found this beauty while foraging for some black trumpets to float on my crab bisque. I’ve been picking culnary mushrooms for over 40 years and have never seen anything like this. That’s why I took to people who know the people to find out. It was in transitional forest with pine,fir,tan oak and a few redwoods. I frequent this area because it has such a wide variety of “chantrells” through the wet season so I would not be surprized if it was of that genus. Although it shares some morel traits, it was all of one base and was about the size of my hand with a cluster of heads. I’m very excited to see the observations this fungus is getting. Keep me posted, E.Taylor


Created: 2012-02-08 04:43:06 WET (+0000)
By: Noah Siegel (Amanita virosa)
Summary: Nice!

Now it’s time to sequence it.

89114

Created: 2012-02-08 04:28:45 WET (+0000)
By: Ryane Snow (snowman)
Summary: under the scope

the spores are non-amyloid, broadly elliptical and smooth, 8-10 microns x 4-5 microns. KOH stains the flesh the same color as the hymenium and stains the hymenium a cinnamon color. I would tend to place this in Cantharellaceae; perhaps an aborted Cantharellus subalbidus.

64455

Created: 2012-02-08 03:18:10 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: both modes can be useful.

It would be interesting to see if this was an exact DNA match for a more mundane Mendo chanterelle, or something completely different.

As to whether it is a chanterelle at all, that is within Ryane’s powers to discover.

202406

Created: 2012-02-08 03:17:00 WET (+0000)
By: Danny Newman (myxomop)
Summary: either way

an addition to the deformities list

43847

Created: 2012-02-08 02:57:14 WET (+0000)
By: Noah Siegel (Amanita virosa)
Summary: DNA this & DNA that…

what happened to looking at it under the scope… It would tell you right away what it was…

I do agree that it looks to be in Cantharellaceae for reasons that Debbie stated.

89114

Created: 2012-02-08 02:39:10 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: several…

general gestalt, other than that weird hymenium of course, is chanterelle-like. inner flesh is dense and white like a chanterelle, not brittle like one of the russulaceae. orangy yellow color is chanterelle-like.

I believe that the one that we collected even smelled fruity, but I didn’t note it in my observation here.

DNA would be interesting on this one. We have seen it at least three different times now.

the hymenium just looks like a weird variation on gill ridges, not spines.

202406

Created: 2012-02-08 02:19:42 WET (+0000)
By: damon brunette (damonbrunette)
Summary: Debbie

would be interesting if this was so. What are some of your reasons for this choice?

113466

Created: 2012-02-07 18:16:19 WET (+0000)
By: Debbie Viess (amanitarita)
Summary: same as this collection from JSF in 2008 :

202406

Created: 2012-02-07 18:02:33 WET (+0000)
By: Christian (Christian Schwarz)
Summary: Well…

I don’t really have any leads, but it reminds of when Hydnum repandum gets all aborted and bizarre-looking. What was the texture like?

Maybe CureCat can post some photos of the aborted ones she’s found.

167312


Created: 2012-02-07 17:57:33 WET (+0000)
Last modified: 2012-04-07 06:38:22 WET (+0000)
Viewed: 744 times, last viewed: 2012-05-17 01:36:54 WET (+0000)
Show Log