Observation 102465: Amanita sect. Vaginatae sensu Zhu L. Yang
When: 2012-07-22
No herbarium specimen

Notes: A single fruitbody growing under pitch pines.
The volva was completely sub-terranean. The cap was smooth and devoid of universal veil remnants.

Proposed Names

-40% (3)
Recognized by sight
57% (1)
Eye3 Eyes3
Recognized by sight: Well-developed saccate volva, striate cap margins, NO annulus
Used references

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
You’re very welcome, Igor.
By: R. E. Tulloss (ret)
2016-12-08 10:41:15 PST (-0800)

When things go well (of course), it’s a lot of fun.

Very best,

Rod

Hello, Rod
By: I. G. Safonov (IGSafonov)
2016-12-08 09:56:43 PST (-0800)

Thank you for investigating A. williamsiae further with regard to it possibly belonging to the “TCT-series” of the Vaginatae. Now we know it does – I guess it’s good to be on a roll. :-)
I hope this collection will prove to be A. williamsiae and deliver “undamaged” DNA for a change. However, I understand that sequence heterogeneity is likely to be an inherent feature of this taxon. — Igor

We’re still on a roll.
By: R. E. Tulloss (ret)
2016-12-08 07:50:04 PST (-0800)

I found badly damaged sequences for a collection of williamsiae from SC. The reverse read has lots of heterogeneity; however, the region around the nrLSU 5’ motif was strikingly free of problems. And Linas provided two copies of the reads in question. SO…here is the region where nrITS ends and nrLSU begins:

GCATGTCTCTCAACCTCACTTTTTATGATTCA*TCTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAG

My notation is unconventional. I inserted an asterisk at the point at which the “proposed fungal barcode” ends and the nrLSU begins. Lo and behold, we have the expected (this time) TCTGACCTCAAATCA.

So Amanitawilliamsiae” is in the unusual grouping within the Vaginatae. This is the first case in which we saw a species in the cluster in some hastily made trees before we found that it had the TCT… variant that we report for the first time, above.

We do seem to be on a roll (of course “rolls” are randomly occurring for the Cleveland Cavaliers as I suspect they are for amanitologists).

Thank you, Igor, for provoking me to look around. Thanks, also, to Ian Dodd for surprising me with a bright-colored species for the TCT-group. I previously thought the group to be composed of drably colored taxa. Wrong again.

Very best,

Rod

Sample was sent on 17 June 2016.
By: R. E. Tulloss (ret)
2016-12-08 05:37:27 PST (-0800)

From the recent data shipments from Linas, I’d say we will see DNA from this specimen within the next six to eight weeks.

From the evidence so far, the nrITS is probably strongly heterogenous. We are only getting small fragments (too small to post in GenBank). The nrLSU is of very variable length. This could be the quality of the DNA that Linas has happened to extract or it could be that there is more subtle heterogeneity involved at that locus also.

I posted on MO the little fragment from “sp-AUS08” that shows the “TCT…” motif for that species. Maybe we will get lucky and pick up a similarly located fragment from williamsiae. I’ve called Linas’ attention to that issue for williamsiae. He is out of town; however, we may connect through email and discuss alternatives. I will go back through the reads that seem to be junk to see if I can find the motif (in roughly the “right” place).

Very best,

Rod

no sequence from RET 503-5 (this material) is in my geneious database
By: R. E. Tulloss (ret)
2016-12-08 05:28:22 PST (-0800)

I still have to find out if the specimen might still be in a queue.

Very best,

Rod

Hello, Igor.
By: R. E. Tulloss (ret)
2016-12-08 05:26:44 PST (-0800)

You asked if this collection has been sequenced. I easily found it in the herbarium, and the label says that it was sent for sequencing.

Now I have to go through the spread sheets to see what happened.

Maybe I will something more to tell you.

Very best,

Ro

hit me with the GPS
By: R. E. Tulloss (ret)
2012-07-24 10:06:43 PDT (-0700)

I’m trying to save the specimen. Maybe we can get more out of it.

R

Thank you, Rod,
By: I. G. Safonov (IGSafonov)
2012-07-24 09:52:30 PDT (-0700)

for your efforst in ID-ing this interesting amanita. It’s a shame the specimen is too young to make mature spore for a conclusive ID. We were all excited about this one when we found it — it was in perfect condition, untouched by bugs or decay. Alas, we found it too early! John took a GPS reading of the spot, so we know where to look for it next time…

I was able to find a few spores in lateral view for measurement.
By: R. E. Tulloss (ret)
2012-07-23 19:47:16 PDT (-0700)

Much of the gills surface is immature however. The spores suggest the possibility of an immature specimen of Amanita homolae; but this has never been collected this far south previously. On the other hand A. homolae is not well known. This collection probably will not produce typical results…whatever the species to which it belongs…unfortunately.

R

The spores are inamyloid and subglobose.
By: R. E. Tulloss (ret)
2012-07-23 19:14:28 PDT (-0700)

I didn’t get to it until 10 pm.

It’s pretty likely that this is in sect. Vaginatae. It’s immature and has been refrigerated. I’ve got to put it in the dryer in order to have a chance to save it. We may never have a name for it. The appearance is so distinctive. I hope that it is found again.

Very best,

Rod

I’m glad you posted images.
By: R. E. Tulloss (ret)
2012-07-23 07:26:02 PDT (-0700)

The first thing this a.m., I can at least eliminate the possibility of whetstoneae with Melzer’s reagent on the spores.

R

Yes, Rod
By: I. G. Safonov (IGSafonov)
2012-07-22 21:19:31 PDT (-0700)

Nina, John and I found it at the North Gate section of the preserve. It would be nice if you could put a name to it…

This was delivered to my door
By: R. E. Tulloss (ret)
2012-07-22 21:03:01 PDT (-0700)

this p.m. by John and Nina Burghardt.

At least, I think this is the specimen that is now in my fridge. I will take a look at it tomorrow.

Very best,

Rod

Could be.
By: Eric Smith (esmith)
2012-07-22 20:26:13 PDT (-0700)

Looks promising. If so it’d be a rare find.

Amanita williamsiae (nom. prov.)
By: I. G. Safonov (IGSafonov)
2012-07-22 19:57:29 PDT (-0700)

This could be “Williams’ Great Ringless Amanita”.

Created: 2012-07-22 19:30:47 PDT (-0700)
Last modified: 2016-12-08 09:58:36 PST (-0800)
Viewed: 179 times, last viewed: 2017-02-04 04:51:57 PST (-0800)
Show Log