Observation 106224: Rhodocybe popinalis (Fr.) Singer
When: 2011-10-18
Herbarium specimen reported

Notes: ITS sequence:
AGAGGAAGTAAAAGTCGTAACAAGG
TTTCCGTAGGTGAACCTGCGGAAGG
ATCATTAATGAGTTAAAATTCGGTTG
GGTTGATGCTGGTTCCTTGGGACATG
TGCACGCCTGCCGCTTCTTAAACCAC
CTGTGCACCTTTGTAGACTGGAAACA
AGATGCTCGAGGCAACTCGGTTGTGA
GAATTGTTGTGCTCGTTCAGAGCCAG
CTGTTCTTGAGTTTCTTTGTCTATGT
CTTTACTATAACACACCATATGTATG
TCTTTGAATGTATTGTTGGGCGTAGT
GCCTTTAAACTTAATACAACTTTCAA
CAACGGATCTCTTGGCTCTCGCATC
GATGAAGAACGCAGCGAAATGCGAT
AAGTAATGTGAATTGCAGAATTCAG
TGAATCATCGAATCTTTGAACGCAC
CTTGCGCTCCTTGGTATTCCGAGGA
GCATGCCTGTTTGAGTGTCATTAAA
AACTCAGCCTTGCAGGTCTTTATCG
ACTTTGCATGGGTTTGGACTTTGGG
ATTTCTGCAGGCTTAGCCACAGTCT
GCTGTCCTTAAATGCATTAGCAAAG
CTTTTGTTGCTGAACTTTTGGTGTGA
TAACTATCATCGCCATTGGGCCAGC
ATGCCTTTTTGAAGCTTGGCTTCTAA
TTGTCTCTTTTAGTGACATTACTTTGA
CAATCTGACCT

Images

252207
Decurrent thick dingy gray-tan gills red in KOH. Cap matte tan, slightly cracking, dark jade-green in KOH.

Proposed Names

28% (1)
Eye3 Eyes3
Recognized by sight: decurrent gray-green gills, pallid tan-gray cap cracking in age
Based on chemical features: gills red in KOH, cap did not go red in KOH, slowly dark jade green with a halo

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No
By: Christian (Christian Schwarz)
2015-03-29 12:47:11 EDT (-0400)

but you always complain about in-hand IDs being unreliable,
so here ya go.

doesn’t really look like Cleistocybe
By: Debbie Viess (amanitarita)
2015-03-29 11:01:43 EDT (-0400)

photos too abbreviated to really see the characters. where’s the micro?

bar codes not too useful for ID in the field or home lab.

Created: 2012-08-20 18:02:56 EDT (-0400)
Last modified: 2012-08-20 18:04:49 EDT (-0400)
Viewed: 65 times, last viewed: 2016-11-28 00:59:42 EST (-0500)
Show Log