Observation 107091: Psilocybe zapotecorum R. Heim
When: 2012-08-26
( 2390m)

Notes: These mushrooms were put on display at the Senguio fungus fair.

Images

255765
IMG_3456.JPG
255761
IMG_3408.JPG
255762
IMG_3409.JPG
255763
IMG_3410.JPG
255764
IMG_3419.JPG
255766
IMG_3452.JPG
255767
IMG_3454.JPG
256185
IMG_3411.JPG
256186
IMG_3415.JPG
256187
IMG_3416.JPG
256188
IMG_3417.JPG
256189
IMG_3423.JPG
256190
IMG_3429.JPG
256191
IMG_3431.JPG
256192
IMG_3435.JPG
256193
IMG_3446.JPG
256194
IMG_3447.JPG
678893
better-tree.jpg
A better tree

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-15 17:26:21 CDT (-0400)

GTTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTG
TGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATA
CCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGC
TCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAAC
GCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGA
TAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTCTAGTCGGCTCCCyTCAAATGCATTAGCCGGTGCCCCGCGCAGAGCC
GTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTCATGGA
CAACTTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

pH balance measurements
By: Image Sharer (image sharer)
2012-08-29 20:31:05 CDT (-0400)

At the risk of sounding obsessive-compulsive, may I ask if you can take one or two pH meter measurements in Ps. zapotecorum soil collections?

Derrumbe
By: A. Cortés-Pérez (Alonso)
2012-08-29 13:04:48 CDT (-0400)

Good collection

Created: 2012-08-26 16:33:16 CDT (-0400)
Last modified: 2016-10-24 00:30:30 CDT (-0400)
Viewed: 222 times, last viewed: 2017-03-19 17:01:25 CDT (-0400)
Show Log