Observation 109788: Russula Pers.
When: 2012-09-15
Herbarium specimen reported

Proposed Names

56% (1)
Eye3 Eyes3
Recognized by sight
28% (1)
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Would you happen to have, and be willing to share,
By: Stephen Russell (Mycota)
2016-08-15 09:21:28 PDT (-0700)

a FASTA file with verified Russula sequences? ITS alone is fine for now. I am going to be looking at most of my Russulas soon, and would be interested in a solid reference.

Here is a verified barcode for R. vinacea to compare against
By: Brian Looney (GibbiPicasso)
2016-08-15 08:51:23 PDT (-0700)

>gi|694190894|gb|KF810139.1| Russula vinacea voucher BPL257 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence
TGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTAAAACTGAG
GCGCGAGGGCTGTCGCTGACCTGAACTCAGGTTGTGCACGTCCGAGCGTCCTCATACATCCATCTCACCC
CTATGTGCACCACCGCGTGGGTCTTCCTTTGGCTCGTCCGAAGGGGGGCTTACGTTTTCACACAAACTTT
GTATGCAGTGTAGAATGTACCTTTGTTTTGCGATCACGCAATTAATACAACTTTCAACAACGGATCTCTT
GGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCAT
CGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATTC
TCAAAACCCTTTTCTTTTTGGGAGAAGGGTTTTGGACTTGGAGGCCTTTTGCTGGCTTTGCCTTGAAGCC
AGCTCCTCCTAAATGAATTAGTGGGGTCCACTTTGCCGATCCTTGACGTGATAAGATGTTTCTGCGTCTT
GTGGTTTGACACTGTCACCCGCTTCTAATCGTCTCATTGACAATTGATGGTGTTCCGGTCACCACCTCTC
TATGGGGTGGTTGGCTTGACCCACAACATGACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA
AGCATATCATA

Maybe try LSU
By: Alan Rockefeller (Alan Rockefeller)
2016-08-13 00:03:08 PDT (-0700)
Closest ITS matches are unknown Monotropa associates in Russulales
By: Stephen Russell (Mycota)
2016-08-11 19:49:54 PDT (-0700)

Created: 2012-09-15 17:55:24 PDT (-0700)
Last modified: 2012-09-16 00:37:09 PDT (-0700)
Viewed: 39 times, last viewed: 2016-08-15 15:33:34 PDT (-0700)
Show Log