Observation 109871: Psilocybe cyanofibrillosa Guzmán & Stamets

When: 2012-09-16

Collection location: Renton, Washington, USA [Click for map]

144m

Who: NeoSporen

Specimen available

Notes:
Culture was produced from original specimens found in 2010. Specimens will be sent off for examination and testing, along with my own microscopy notes once mature specimens are ready to harvest.

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS Sequence
By: Alan Rockefeller (Alan Rockefeller)
2018-01-17 07:37:30 EST (-0500)

I got a sequence back for this but the results aren’t very believable, I think it might have gotten switched for a sample from India which was two tubes to the left.

But anywhere here is what it says:

GGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACCTTTTGTAGACCTGGATTAGTTAACTTTCCGAGGAAACTCGGTCGGGAGGATTGCTTTCACAAGCTCTCCTTGCAATTAACCCAGGCCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTATATTGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGG

Created: 2012-09-16 10:42:34 EDT (-0400)
Last modified: 2018-01-17 07:37:32 EST (-0500)
Viewed: 560 times, last viewed: 2018-01-19 20:07:42 EST (-0500)
Show Log