Observation 111110: Inocybe lilacina group

When: 2012-09-22

Collection location: Ajusco, Mexico, Mexico [Click for map]

3000m

Who: Alan Rockefeller (Alan Rockefeller)

Specimen available

Notes:
Under Abies religiosa.

ITS sequence:

ACCGGCTGTTTTATTTGCTNACTTTTNNAGAGCTCATGTGCACGCTTCAAAATCTTTGTCATTTCTCCAAANAGTGCACATACTGTAGACCTGAGGGGAGCAATGAATTTCCATTCGAGTTGGGGATTGCTGTGNTTAATTTAAAAAAAGTCGGCTTTCCCTTGTATTTTTTCAGGTCTATGTTGTTTTTCACAACCTCTATAACATGTTTAGAATGTTGAATTAAGGTCTTTGTACCTATATAAAAGTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGACCTTCTCAACCACATCGTTCTTGTTTTGAATGTGTGTGGCTTGGATGTGGGGGAATATTTTGCAGGCTTCAAAATCAAAGAAGTCGGCTCCCCTGAAATGCATTAGTGGTGTCTGAGCTGCTATTGGTGTGATAAATTATCTATGCCTTTGGTGATGCTGGTCAGCACTGCTTATAACGGACGGTGATCATTTGACAAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGCAGCTCTTTGAACTGTCCGAGTTGTAATCTAAAGANGTGTTACCTGTGCTGGACCGTGTACAAGTCTCCTGA

Proposed Names

87% (1)
Eye3 Eyes3
Recognized by sight: Not the same as the Peck species from New York – the gold top of the cap is different, as is the DNA sequence

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Added ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2014-06-07 20:57:06 PDT (-0700)

The closest match is GenBank: HQ604297.1, also known as observation 71409, a Ceska observation from BC, Canada with 752 out of 795 base pairs matching (95%).

Created: 2012-09-24 14:49:44 PDT (-0700)
Last modified: 2014-09-26 19:44:52 PDT (-0700)
Viewed: 144 times, last viewed: 2018-01-11 10:20:29 PST (-0800)
Show Log