Observation 111110: Inocybe lilacina group
When: 2012-09-22
( 3000m)
Herbarium specimen reported

Notes: Under Abies religiosa.

ITS sequence:

ACCGGCTGTTTTATTTGCTNACTTTTNNAGAGCTCATGTGCACGCTTCAAAATCTTTGTCATTTCTCCAAANAGTGCACATACTGTAGACCTGAGGGGAGCAATGAATTTCCATTCGAGTTGGGGATTGCTGTGNTTAATTTAAAAAAAGTCGGCTTTCCCTTGTATTTTTTCAGGTCTATGTTGTTTTTCACAACCTCTATAACATGTTTAGAATGTTGAATTAAGGTCTTTGTACCTATATAAAAGTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGACCTTCTCAACCACATCGTTCTTGTTTTGAATGTGTGTGGCTTGGATGTGGGGGAATATTTTGCAGGCTTCAAAATCAAAGAAGTCGGCTCCCCTGAAATGCATTAGTGGTGTCTGAGCTGCTATTGGTGTGATAAATTATCTATGCCTTTGGTGATGCTGGTCAGCACTGCTTATAACGGACGGTGATCATTTGACAAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGCAGCTCTTTGAACTGTCCGAGTTGTAATCTAAAGANGTGTTACCTGTGCTGGACCGTGTACAAGTCTCCTGA

Proposed Names

87% (1)
Eye3 Eyes3
Recognized by sight: Not the same as the Peck species from New York – the gold top of the cap is different, as is the DNA sequence

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Added ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2014-06-08 00:57:06 ART (-0300)

The closest match is GenBank: HQ604297.1, also known as observation 71409, a Ceska observation from BC, Canada with 752 out of 795 base pairs matching (95%).

Created: 2012-09-24 18:49:44 ART (-0300)
Last modified: 2014-09-26 23:44:52 ART (-0300)
Viewed: 137 times, last viewed: 2016-10-24 12:11:53 ART (-0300)
Show Log