Observation 111153: Pleuroflammula tuberculosa (Schaeff.) E. Horak
When: 2012-09-24
Herbarium specimen reported

Proposed Names

vjp
-11% (4)
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Gymnopilus
By: Rocky Houghtby
2017-05-04 13:55:11 PDT (-0700)

Forms a monophyletic group with Galerina subg. Galerina sect. Mycenopsis (sensu Gulden), although all of the hits in that blast seem to correspond to other species in sect. Galerina, and subg. Tubariopsis.

Weird
By: Django Grootmyers (heelsplitter)
2017-05-04 11:39:08 PDT (-0700)

I didn’t notice how high up in the results this Galerina vittiformis voucher is. That might make this pretty close to Galerina sensu stricto since that’s the type species — if this really does represent G. vittiformis. Petersen et al. didn’t have any sequences of G. vittiformis. It looks like the sequence will be part of a work on “Inocybes and other fungi of the Pacific Northwest” which seems pretty interesting.

Petersen et al. (2010)
By: Django Grootmyers (heelsplitter)
2017-05-04 11:30:03 PDT (-0700)

…found this species to be the most basal member of their “crepidotoid” clade, with the topology (Pholiota tuberculosa + ((Pleuroflammula + Inocybe) +
(Simocybe + Crepidotus))). Out of those clades, only (Simocybe + Crepidotus) was fairly robust though. It could be that this needs a new genus. It likely isn’t very close to Pholiota, but the whole “agaricoid” clade is pretty poorly resolved. Galerina in the current sense (anyone know what “sensu ___” this would be?) is definitely polyphyletic, so it could be that some members are closer to this than to Galerina. Here’s the link. It’s not open access but I can send anyone interested a PDF of the article.

Interesting
By: Rocky Houghtby
2017-05-04 11:17:29 PDT (-0700)

How similar it is to all of those Galerina, yet no other Pholiota appear in the results.

Cool!
By: Django Grootmyers (heelsplitter)
2017-05-04 11:16:40 PDT (-0700)

I may have overlooked these as a Gymnopilus species. I definitely don’t have any specimens of this though.

ITS
By: Stephen Russell (Mycota)
2017-05-04 11:03:30 PDT (-0700)

GCGGAAGGATCATTAATGAATAAACTTGAAGAGTTGTCGCTGGCGCTCTCCGGAGCCGCATGTGCACGCTCGACATCTTTATATCTCCACCTGTGCACTTTTTTGTAGACTTGGAATTTGTTTATTTTTCGAGGGCAACCTTGAACAGGAGGACTTGACGTGTTAGCGGGGGGCAAACCCTGGTAGCCGGCTGTCCTTGAAGTGGATTCCAAGGCCTATGTTTTTTTCATATACTCCAATGAATGTAATAGAATGTGTATTAAAGGGCTTTGTACCTTATAAAACTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTGTACGAGTTTTATTACTTGTTCAGCTTGGATGTGGGGGTTTTGTGGGCTTCAATTCTGAAGTCTGCTCCCCTGAAATGAATTAGCGGTATGGAATCCGTCTATTTTGGTGTGATAAATATCTACGCCCATTGGACATTCTACAATGCTGCTTTCTAACTGTCTGTTCACTGGACAATTAATGACCATTTTTGACCTCAAATC

Was this ID based on sequencing?
By: Django Grootmyers (heelsplitter)
2017-05-04 10:55:41 PDT (-0700)

Created: 2012-09-24 20:00:05 PDT (-0700)
Last modified: 2017-05-04 11:15:12 PDT (-0700)
Viewed: 138 times, last viewed: 2017-07-19 23:11:11 PDT (-0700)
Show Log