Observation 113564: Psilocybe fagicola R. Heim & Cailleux
When: 2012-10-15
(19.5177° -97.0584° 2644m)

Notes: Under pine.

Looks slightly different than the other species I found today – cap expands more and is more purple.

Images

272472
IMG_8887.JPG
272466
IMG_8878.JPG
272467
IMG_8881.JPG
272468
IMG_8882.JPG
272469
IMG_8884.JPG
272470
IMG_8885.JPG
272471
IMG_8886.JPG
272473
IMG_8888.JPG
272474
IMG_8889.JPG
272475
IMG_8890.JPG
314204
IMG_8947.JPG
314205
IMG_8950.JPG
314206
IMG_8951.JPG
314207
IMG_8952.JPG
314208
IMG_8953.JPG
314209
IMG_8954.JPG
314210
IMG_8956.JPG
314211
IMG_9034.JPG
314212
IMG_9035.JPG

Proposed Names

-16% (2)
Eye3
Based on microscopic features: Need to check the microscopic features to verify
81% (1)
Eyes3
Based on microscopic features: Only the largest basidioma is Psilocybe fagicola, little is Psilocybe neoxalapensis
spores 5-6 × 4.5-5 (6) x 3.5-4.5 µm
pleurocystidia 14-19 × 4-5 µm
cheilocystidia one type 17-30 x (4) 5-7 (8) µm

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
LSU sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-27 16:18:00 CDT (-0500)

With 5.8sr & lr0r primers.

TCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAA
ATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTTGCTGGCTTCCTCAAGA
GGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTAC
GCCGTGGACCTTTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAATACAAATGACAA
TTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAA
CAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCG
TCCGAGTTGTAATCTAGAGAAGTGTTGTCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCAT
AGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTG
TTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCG
AACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAA
AGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGGGATCAACCTTGCTTTTGCTGGGTGTACTTTCCGGTT
GACGGGTCAGCATCAATTTTGACCGTTGGATAAAGGCTTTGGGAAAGTGGCTTCTTCGGAAGTGTTATAG
CCCATGGTCGCATACAACGGTTGGGATTGAGGAACTCAGCACGCCGAAAGGCGGGTACTTGTACCACGTT
CGTGCTTAGATGCTGGCATAATGGCTTTAATCGACCCGTCTGAAACACGGACCAG

A video of the neoxalapensis
By: Alan Rockefeller (Alan Rockefeller)
2013-03-04 20:36:08 CST (-0600)

Created: 2012-10-16 01:40:41 CDT (-0500)
Last modified: 2012-11-13 14:28:29 CST (-0600)
Viewed: 146 times, last viewed: 2016-06-26 20:49:37 CDT (-0500)
Show Log