Observation 114447: Panaeolus papilionaceus (Bull.) Quél.
When: 2012-10-14
19.0696° -97.2689° 4052m
Herbarium specimen reported
0 Sequences

Notes:
In cow dung. Very high elevation – found well above the tree line.

Spores 16 – 17 × 8 – 9, lemon shaped.

Cheilocystidia subcylindric to subcapitate.

Herbarium specimen in the “Orizaba 2012” bag.

ITS sequence: AATCGTCATTATCGAATAAACTGGGTGGGTTGTTGCTGTCCCTCTCGGGGGAACTGTGCACGCCTTACCTTTTTTGTTTTTCCACCTGTGAACACACTGTAGGTCTGGAGGGAAGGGAAGCAATTCCTTGACGTTCAGGTCCTATGCTTATACATATACACTATTGAAAGTAACAGAACGATTCAATGGGCTCTAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCATCGCTTTTGTGATGATGGCTTGGATGTGGAGGTTTCTGCAGGCCGAAAGGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGTCTAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCATTGACTTGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTCGATTGTCCGAGTTGTAATCTAGAGAAGCATTATCCGCGCTGGACCGTGTACAAGTCTCCTGA

Species Lists

Images

275372
IMG_8757.JPG
275369
IMG_8747.JPG
275370
IMG_8751.JPG
275371
IMG_8752.JPG
275373
IMG_8759.JPG
A young specimen
277607
IMG_9306.JPG
Cheilocystidia 100x
277608
IMG_9309.JPG
Cheilocystidia 100x
277609
IMG_9313.JPG
Spores 1000x
277610
IMG_9314.JPG
Spores 1000x

Proposed Names

29% (1)
Recognized by sight
87% (1)
Eye3 Eyes3
Recognized by sight: In cow dung. Dark colored stem.
Based on microscopic features: Spores 16 – 17 × 8 – 9, lemon shaped. Cheilocystidia subcylindric to subcapitate.
Based on chemical features: 100% DNA match for http://www.ncbi.nlm.nih.gov/nucleotide/308097432, which is a synonym of Panaeolus papilionaceus according to Gerhardt 1996

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF628989
By: Alan Rockefeller (Alan Rockefeller)
2017-09-04 12:11:58 CST (+0800)
ITS Sequence
By: Alan Rockefeller (Alan Rockefeller)
2014-05-30 03:33:36 CST (+0800)

The first sequence I made at Berkeley Bio Labs came back this morning – It’s a 100% match with several Panaeolus papilionaceus sequences in Genbank. The same sequence was found in a mushroom in Italy and an air filter sample in Germany.

Created: 2012-10-25 11:25:59 CST (+0800)
Last modified: 2014-05-30 03:42:36 CST (+0800)
Viewed: 133 times, last viewed: 2017-10-01 01:11:15 CST (+0800)
Show Log