Observation 114463: Psilocybe neoxalapensis Guzmán, Ram.-Guill. & Halling
When: 2012-09-18
( 2600m)

Notes: First collection of the day, 3 – 4 fruit bodies.

Herbarium specimen is in the Institute of Ecology in Xalapa.

Images

314221
IMG_6974.JPG
314220
IMG_6972.JPG
314222
IMG_6976.JPG
314223
IMG_6978.JPG
314224
IMG_6983.JPG
314226
IMG_6989.JPG
314227
IMG_7000.JPG
314228
IMG_7001.JPG
314229
IMG_7002.JPG
615715
psilo.jpg
678893
better-tree.jpg
A better tree

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-06 22:25:56 PDT (-0700)

AGGTTGTGCTGGTCCTTTCGAGGACATGTGCATGCCTTGTCATCTTTATCTATCCACCTGTGCACCTTTT
GTAGACTTGGTTATAGTGAACGGGAGAGCATGCTCTCCTTGAAGCTATGCTAGGCCTATGTTTTCATATA
CCCCAAAAAATGTAATAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGG
ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAAAATTCAGT
GAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAT
TAAATTCTCAACCTTAATAGCTTTTGCTGTTAATGGCTTGGATGTGGGGGTCTATTTTGCTGGCTTAGGT
CGGCTCCCCTCAAATGTATTAGCCGGTACCCTGCGTGGAGCCGTCTATTARTGTGATAATTATCTACACT
GTTAGACCTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTTGGACATATCATGACAATTTGAC
CTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGA

Created: 2012-10-25 12:27:54 PDT (-0700)
Last modified: 2016-12-09 16:28:22 PST (-0800)
Viewed: 68 times, last viewed: 2017-01-22 20:22:22 PST (-0800)
Show Log