Observation 116193: Conocybe romagnesii Hauskn. & G. Moreno
When: 2012-08-11
Who: Byrain
Herbarium specimen reported

Notes: Growing in grass near the Bolbitius in observation 106483, same as the species in observation 73806.

Spores with 1 µm wall & minute germ pore
Spore range = 12 – 15 × 9 – 11 µ
Average spore = 13.15 × 9.7 µ
Q range = 1.3 – 1.56
Average Q = 1.36
Cystidia not observed
2-spored basidia observed
20 spores measured

Images

280767
280768
280769
Spores, 1000x, mounted in KOH, 1μ divisions
280770
Spores, 1000x, mounted in KOH, 1μ divisions
280771
Pileipellis, 1000x, mounted in KOH
325713
Spores, 1000x, mounted in H2O
325714
Lecythiform cheilocystidium, 1000x, mounted in H2O, 1μ divisions

Proposed Names

28% (1)
Recognized by sight
85% (3)
Eye3 Eyes3
Recognized by sight
Used references: http://bit.ly/104ke9s
Based on microscopic features: Hyaline thick walled spores with no germ pore, lecythiform cheilocystidia

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-24 11:12:04 PDT (-0700)

A 100% match with http://www.ncbi.nlm.nih.gov/nucleotide/437037542 from Italy.

TAACTTGATGGGTTGTAGCTGGCTCTAACTTGAGTATGTGCACACCTGTCATTTTTATCTTTCCACCATGTGCACTTTGCATAGGTCTGAAAATCACTAGTCCTTGTGGACTTTTGATGTCTTGGGAACTGCTGTTCTTCACAGTCAGCTTTTCCTGTCTTCAGGCTCTATGATTTTTATATACACCATGTATGTTAAAGAACGCTTTACAGGCCTTCAAAGCCTATAAACATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCTCTACAACTTTGTTGTTAGTAGGTTGGAAGTGGGGGCTTTTTGTGAGATGTTTTAGTACGTCCCACTCCCCTGAAATGAATTAGCTGGAATGCCTCGGCAAATCCAACTATCAGTGTGATAAATATCTACTGTGGTTGTTGCATGAGGGTATCTGCTTCTCAACTGTCTGCAAAGACAACTTGAATCATTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

There is…
By: Byrain
2013-05-01 22:02:40 PDT (-0700)

a pileipellis picture and another terrible near useless one in observation 73806. When scoping this again today the pileipellis did match the illustrations given with the description. Finding cystidia was a chore, these tend to crumble instead cut into workable sections and I only saw a few cheilocsytidia. I’m hoping to find this again and get better microscopy while fresh later this year.

Darn,
By: Douglas Smith (douglas)
2013-05-01 21:23:56 PDT (-0700)

That is a really interesting id. Probably not exactly that species, since it was only seen around Madrid, or very strange to hop to the central valley-ish. But probably related somehow… need more details now. We need to see the pileipellis, and caulocystidia, and it might be nice to see a gill edge with a series of cystidia.

Nice
By: Christian (Christian Schwarz)
2013-05-01 17:14:33 PDT (-0700)

good lead Byrain.

I’ve seen these before
By: Randy Longnecker (Randy L.)
2012-11-11 08:51:50 PST (-0800)

in the central valley, and always wondered what they were. Hope you figure it out.

Could be…
By: Byrain
2012-11-11 08:28:59 PST (-0800)

If obs 74013 is the same as 106483, then I have seen that Bolbitius in 2 of the 4 locations I have seen this. Unfortunately there is no DNA yet, I’ll have to give more specimens for that soon. :)

Edit: Except it just occurred to me that this has a bulbous base and that Bolbitius doesn’t…

maybe
By: Christine Braaten (wintersbefore)
2012-11-11 08:17:16 PST (-0800)

Its an infection or mutation affecting your 106483 species.

Those
By: Byrain
2012-11-11 08:04:05 PST (-0800)

have an expanding cap, I’ve never noticed these to do that the few times I have observed them. The closest I have seen are:

http://mushroomobserver.org/113754?q=qJfQ

Excluding the location and habitat, but I wouldn’t be surprised if they were in the same genus.

sort of look like these
By: Christine Braaten (wintersbefore)
2012-11-10 23:19:25 PST (-0800)

http://www.flickr.com/photos/30273407@N02/2948882512/

spores should not be hyaline though.

Un chingón de una colección
By: Alan Rockefeller (Alan Rockefeller)
2012-11-09 14:22:31 PST (-0800)

Reminds me of observation # 23. This observation is a notable exception to Rule # 34.

Not yet…
By: Byrain
2012-11-09 02:41:47 PST (-0800)

I think there should of been some dna done on the last collection, but haven’t heard anything, I’ll see if I find out more…

this thing again
By: Danny Newman (myxomop)
2012-11-09 01:44:38 PST (-0800)

any new leads, Byrain?

Created: 2012-11-08 23:38:42 PST (-0800)
Last modified: 2016-06-24 15:20:34 PDT (-0700)
Viewed: 207 times, last viewed: 2016-11-23 23:01:53 PST (-0800)
Show Log