Observation 116752: Agrocybe putaminum (Maire) Singer
When: 2012-11-09
Who: Byrain
Herbarium specimen reported

Notes: Spores with ~ 1 μm wide germ pore
Spore range = 12 – 15 × 7 – 9 μ
Average spore = 13.75 × 7.95 μ
Q range = 1.5 – 1.88
Average Q = 1.73
20 spores measured.

The cheilocsytidia, pileocystidia, caulocystidia were abundant, the pleurocystidia was rare & scattered, the basidia was 4-spored. All cystidia and basidia sometimes with brown contents observed in KOH and occasionally had clamps at the base, clamps were also observed on the gill & stem hyphae.
Cheilocystidia range (13 measured) = (19) 31 – 53 (58) x 9 – 17 μ
Average cheilocsytidia = 40.62 × 11.08 μ
Pleurocystidia measured = 39×19, 41×16, 48×19, 49×20, 53×18, 53×24 μ
Basidia measured = 30×9, 35×10 μ
Pileocystidia range (10 measured, one over 100 μ long) = (41) 57 – 71 (73) x 9 – 12 μ
Average pileocystidia = 63.75 × 10.1 μ
Caulocystidia range (20 measured) = (35) 36 – 68 (73) x 9 – 15 (17) μ
Average caulocsytidia = 50.1 × 12.15 μ

The taste and smell were farinaceous.

Images

282567
282568
282569
282570
Spores, 1000x, mounted in KOH
282571
Spores, 1000x, mounted in KOH
282572
Spores, 1000x, mounted in KOH, 1μ divisions
282573
Cheilocystidia
282574
Pleurocystidia
282575
Cap cross section, 40x mounted in KOH,
282576
Pileocystidia
282577
Stem scalp section, 40x, mounted in KOH
282578
Caulocystidia
282579
Caulocystidia
629115
Copyright © 2016 Alan Rockefeller

Proposed Names

92% (2)
Eye3 Eyes3
Recognized by sight
Used references: Flora Agaricina Neerlandica 6
Based on microscopic features

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Pileocystidia
By: Byrain
2016-06-25 09:48:07 CDT (-0500)

This collection sure did have an overabundance of pileocystidia, assuming this is not a variable characteristic it would be hard to miss.

I don’t think that just one micro feature is likely to be taxonomically significant
By: Alan Rockefeller (Alan Rockefeller)
2016-06-25 01:33:44 CDT (-0500)

Pileocystidia can be variable, occurring in some parts of the cap and not others. It would take careful examination of several collections to know for sure. Seems sketchy to claim that there is a whole different species out there….and the main difference is that it has pileocystidia. The overlapping pleurocystidia size isn’t very convincing either.

Agrocybe smithii
By: Byrain
2016-06-25 00:04:23 CDT (-0500)

On paper Agrocybe smithii is easy to identify microscopically, lacking pileocystidia should be a clear cut difference with A. putaminum.

15. Pileus young with olivaceous tinge; pileocystidia lacking; spores up to 14.5
× 8.5 µm in size; pleurocystidia globose, 25–40 µm long . . . . . . . . . . A. smithii Watl. & Bigelow in Mycotaxon
17: 378. 1983; not yet found in the Netherlands. According to Enderle
(in Doc. mycol. 25(100): 147–150. 1995) occurring in southern Germany.
15. Pileus without olivaceous tinges; pileocystidia present; spores up to 13.5 × 7.5 µm in size; pleurocystidia clavate or utriform, 35–55(65) µm long . . . . . . . . . . . . . . . . . . 8. A. putaminum

We need some European sequences.
By: Byrain
2016-06-24 21:25:22 CDT (-0500)

Especially given that this is an European name…

Phylogenetic tree
By: Alan Rockefeller (Alan Rockefeller)
2016-06-24 21:12:31 CDT (-0500)

Here is a tree which includes this collection. It is the same as specimens from New Zealand and from Michigan. The Michigan collections are labeled A. smithii – they may be misidentified, or the two species might be conspecific. If they are the same, the name A. putaminum takes precedence because it is older.

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-24 20:31:11 CDT (-0500)

GGCGTGGTTGTAGCTGGCCCTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCCTTTGTAGACCTGGACGATAACTTTCCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTTCACGAAGTCGGCTTTCCTTGTATTATCCAGGCCTATGTTATTCACATACCCCAAAGAATGTAACAGAATGTATCATATGGCCTCGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTATTAGCTTTTGCTGATAATGGCTTGGACTTGGGGGTCTCTTTTGCTGGCTTTCATTAGTCTGCTCCCCTTAAATGTATTAGCCGGCGCCCCGCAGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCTTTTAAATGGGATTGTGCTGCTTCTAACCGTCTGTTGACTCGGACAATACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCAT

I ate one.
By: Byrain
2012-11-14 03:10:51 CST (-0600)

One was fried up with oil, salt, & pepper. It tasted better then expected and the farinaceous taste disappears with cooking, I did not get sick. It will be interesting to try these again with an actual recipe.

More info on this species’ edibility can be found here – bit.ly/SLC2Td

Created: 2012-11-14 02:07:14 CST (-0600)
Last modified: 2016-06-24 21:20:34 CDT (-0500)
Viewed: 200 times, last viewed: 2016-10-27 20:26:29 CDT (-0500)
Show Log