Observation 118441: Alternaria Nees
When: 2012-11-28
No herbarium specimen

Notes: Identifying Features:

1) Muriform conidia, not produced from flask shaped fertile cell.
2) Conidia produced by budding directly from parent hypha or previous conidium.

DNA Sequence was blasted, and the result was consistent with the genus Alternaria.

>>[GGAAAGCTAGAAGACTGAGCGCCTTCAGAGTTGAAACCAAGCCTAAAGGACGCGAGACCTTTGCTGATAGAGAGTGCGACTGGGGCTGCGCTCCGAAACCAGTAGGCCGGCTGCCAATTACTTTAAGGCGAGTCTCCAGCAAAGCTAGAGACAAGACGCCCAACACCAAGCAAAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAATTATTAATTTGTTACTGACGCTGATTGCAATTACAAAAGGTTTATGGTTGTCCTAGTGGTGGGCGAACCCACCAAGGAAACAAGAAGTACGCAAAAGACAAGGGTGAATAATTCAGCAAGGCTGTAACTCTTTTGTGGTTCCAGCCCGCCTTCATATTTGTGTAATGATCCCTCCGCAGGTTCACCTACGGAGACCTTGTTTCGTTTTTTTACTTCCTCTAAATGACCAAGAGA]<<

Proposed Names

76% (1)
Eye3 Eyes3
Recognized by sight
Based on microscopic features
Based on chemical features: DNA sequence data from ITS4.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2012-11-30 14:09:40 PST (-0800)
Last modified: 2012-11-30 14:09:42 PST (-0800)
Viewed: 32 times, last viewed: 2016-10-27 21:55:53 PDT (-0700)
Show Log