Observation 118691: Mucor racemosus Bull.

When: 2012-10-25

Collection location: Oakland, California, USA [Click for map]

Who: Trevor Dolinajec (tdolinajec)

No specimen available

Notes:
Growing at what is likely rodent dung.

Species Lists

Images

288977
The collected dung after wetting.
288976
The collected dung after wetting.

Proposed Names

75% (1)
Eye3 Eyes3
Based on chemical features: Sequence:ATTTACTTGCTGAGCCGGTGACTGCGGAGGACATTAAATAATCAATAATCTTGGCTTGTCCATTATTATCTATTTACTGTGAACTGTATTATTATTTGACATTTGAGGGATGTTCCAATGTTATAAGGATAGACATTGGAAATGTTAACCGAGTCATAATCAGGTTTAGGCCTGGTATCCTATTATTATTTACCAAATGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTTTTTTAAATTTGATCTGAAATCAGGCGGGATTACCCGCTGAACTTAAGCATATCAATAGGCGGAGGAAA

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2012-12-02 20:01:37 PST (-0800)
Last modified: 2012-12-02 20:01:39 PST (-0800)
Viewed: 26 times, last viewed: 2017-11-11 08:16:26 PST (-0800)
Show Log