Observation 118691: Mucor racemosus Bull.
When: 2012-10-25
No herbarium specimen

Notes: Growing at what is likely rodent dung.

Species Lists

Images

288977
The collected dung after wetting.
288976
The collected dung after wetting.

Proposed Names

75% (1)
Eye3 Eyes3
Based on chemical features: Sequence:ATTTACTTGCTGAGCCGGTGACTGCGGAGGACATTAAATAATCAATAATCTTGGCTTGTCCATTATTATCTATTTACTGTGAACTGTATTATTATTTGACATTTGAGGGATGTTCCAATGTTATAAGGATAGACATTGGAAATGTTAACCGAGTCATAATCAGGTTTAGGCCTGGTATCCTATTATTATTTACCAAATGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATTCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTTTTTTAAATTTGATCTGAAATCAGGCGGGATTACCCGCTGAACTTAAGCATATCAATAGGCGGAGGAAA

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2012-12-03 11:01:37 WIB (+0700)
Last modified: 2012-12-03 11:01:39 WIB (+0700)
Viewed: 25 times, last viewed: 2017-06-15 00:06:26 WIB (+0700)
Show Log