Observation 118717: Fungi Bartl.
When: 2012-10-22
No herbarium specimen

Notes: It might be Hemicarpenteles paradoxus according to NCBI. Fungi found from duck feces collected from Tilden Park in Berkeley, CA. DNA was sequenced using the ITS1F locus.

DNA sequence: TGGATACCAATCCTCATCAGAGGTGAACTGCGGAGGATCATTACTGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTGTACCTTGTTGCTTCGGCGGGCCCGCCCTTGTGGCCGCCGGGGGGCTTACGCTCCCGGGCCCGCGCCCGCCGAAGACACCCACGAACTCTGTATGAAGATTGCAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCAATGAAGAACGCAACGAAATGCGATACGTAATGTGAATTGCAAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCGACCAAATTTTTATCCATGGTTGACCTCGGATCATGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAAGGAGAC

This fungi looks like a mass of white fuzz to the naked eye. It seems to resemble Aspergillus and Penicillium. I was told that Hemicarpenteles is a Penicillium that looks like an Aspergillus.

Images

289081
compound microscope
289082
closeup on conidiaphore
289083
closeup on conidiaphore
289084
macroscopic picture
289085
closeup of the macroscopic picture
289086
Fungi on dung

No names have been proposed yet.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2012-12-03 02:46:38 CST (-0500)
Last modified: 2012-12-03 02:46:39 CST (-0500)
Viewed: 15 times, last viewed: 2016-09-20 16:46:17 CDT (-0400)
Show Log