Observation 118759: Mucorales (Fr.)
When: 2012-10-31
No herbarium specimen

Notes: This fungus was found on ground squirrel dung. It is unclear the genus of the fungus, but we guess it is apart of the order Mucorales. This fungus was found and isolated by Melina K. Here is the DNA sequence.

TCATAGAACACAGTAGGAGGACTGCGGAGGATCATTAAATAATTTGATTTAAAAAAAAATTTTTTTTTTTTTTTAAATATTTCCATTTTTACGGGGAACGGTTTTATTACG
AGACGCTTGAGGGAGGCCCGCCGACTATAAGGGATAGGGCGGCAGGATGGGAACCGAGTCTGGATCAGGCCAATTTTTTTTTCGGCCGGGTATCCTAAATTATTATTTCCC
AAAAGAATTCGGTATAAAAATATTGTAACATAACCCTAAAAAATCTATAAAAACAACTTTTAACAACGGATCTCTGGGTTCCCCCTTCGATAAAAAACGAACCAAAGTGCG
ATAACTAGGGTGAATTGCTCTTTCAGGGAATCACCAAGTCTTTGACCCTTCTTGCCCCCATTGGTATTCAATGAGCCCCCTGTTTCAGTTCAAAACCCCAAATTTTGGTAT
TTTTATTTATTTAAGGGAAAGAGTTTTTTTTTTGCCCAAAAAATTTTTTTTTGCCACTGCCCTAAAATATTCGCCTGAATATTTTCTCTGCTGACCTTTTTAAAAGAAATC
TCTGCGAGGAAGGGGGCTCCAATAACTTGTTAAATTGATTAATCGGAGGATTACCCGTAATTATCTTAATAACCGGAGA

Species Lists

Images

289256
Mature sporangiophores
289255
Fungus isolated on agar. Fuzzy white growth with grey sporangiophores.
289257
Different size/shape of sporangiospores.
289258
NCBI Blast of DNA sequence. Mucor flavus is present. (http://blast.ncbi.nlm.nih.gov/Blast.cgi)
289259
Created phylogenic tree on NCBI website. (http://www.ncbi.nlm.nih.gov/blast/treeview/treeView.cgi#)

Proposed Names

51% (1)
Eye3 Eyes3
Based on microscopic features

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
beautiful micrograph
By: Debbie Viess (amanitarita)
2012-12-04 04:44:09 JST (+0900)

got a dissecting scope photo of the entire fruiting structure?

the recurved stalk that bears the sporangia reminds me of Thamnostylum piriforme
(illustration in Dung Fungi of New Zealand by Ann Bell).

Created: 2012-12-04 04:31:55 JST (+0900)
Last modified: 2012-12-04 04:37:56 JST (+0900)
Viewed: 36 times, last viewed: 2016-03-26 04:04:12 JST (+0900)
Show Log