Observation 130970: Pholiotina utricystidiata Enderle & Hubner
When: 2013-03-28
Who: Byrain

Notes: Growing with a potted Echinopsis pachanoi, the soil consists of Black Gold Cactus Soil Potting Mix and some very old horse dung.

Spore range = 10 – 12 x (5.5) 6 μm
Average spore = 10.85 × 6 μ
Q range = 1.67 – 2
Average Q = 1.81
Cheilocsytidia measured = 31×9, 31×12, 33×12, 34×12, 36×12 μ
Pleurocystidia not observed, basidia 4-spored one which was observed on the upper/middle stem, clamps present, hyphae on the pileus encrusted.

Proposed Names

94% (3)
Eye3 Eyes3
Recognized by sight
Used references: Flora Agaricina Neerlandica vol 6
Based on microscopic features: Large spores, utriform cheilocystidia with a broadly rounded apex 6 – 12 μm wide, 4-spored.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-24 15:22:43 CDT (-0400)

Three base pairs away from http://www.ncbi.nlm.nih.gov/nucleotide/437037598, a collection from Germany.

CTGATGGAATGTAGCTGGCTCTCTCGGGAGCATGTGCACCTCCGTCATCTTTATCTTTCCACCTGTGCACCCTTTGTAGAGTAACTGTTTGAAGGACTGGCCGGCCCCCTTGGGGCAAAAAGGTTCTCTCTTTCAGCCTCTACGTTTATTATCTATACACGCATGTCTAAGAATGTAATCATAAAGGCCGTACAAAAGCCTATATAAACAAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATCATCAAAGCCTTTCCAGTTTTGCGACTGGGGGGGACTTTGGACTTGGGAGTGCTGTTGGCTGCTTGCGGTCGACTCTCCTCAAAATCATTAGCCGGTAAATGCTCTTTGCACACACTGGACGCATGGCGTGATAACTATCAATGCCCCGTCTTGGTGAAAGCAACTTAGTCATGGGCGCTTACGCTTCTAACCGTCCCTCTGGGACACTATTTGACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA

Ok, right…
By: Douglas Smith (douglas)
2013-03-29 15:55:26 CDT (-0400)

Right, that 2- to 4-spored difference. They do make a big deal about that in the Conocybe studies. But also, looking at these obs. again, my obs. of P. teneroides has different cystidia. Those are really globose, much wider. and here they are longer than wide at least. More diversity in Pholiotina.

For Pholiotina aporos you can look at my observation 44402 for comparison. Turns out that guy was a rather common enough species in the spring in the Geneva area. Actually the common wisdom in the area there, it is the only Pholiotina in the spring, all others are in the late fall, so people id it without a scope there.

Douglas
By: Byrain
2013-03-29 14:56:55 CDT (-0400)

P. teneroides is 2-spored and P. utricystidiata is 4-spored, I’m certain all the basidia I saw were 4-spored. I have the specimens from observation 127696 and plan to look at it soon, its near the top of the pile of things to look at.

Also, other annulate species of Pholiotina with utriform cheilocsytidia are P. hadrocystis with smaller spores and P. aporos also with smaller spores, but with no germ pore.

And this on the differences from FAN6.

“It is close to Pholiotina teneroides and differs mainly in predominantly 4-spored basidia and smaller, relatively slightly broader spores”

Other ones…
By: Douglas Smith (douglas)
2013-03-29 14:40:12 CDT (-0400)

Well, there are two other obs. of Pholiotina with utriform cystidia here: observation 7291, and observation 127696.

I had id’ed these are P. teneroides. I remember that Pholiotina utricystidiata was a very similar species, but I can’t remember the difference right now, and why I went with one name over the other. I’ve got a bunch of notes on my id at the first obs. there.

These are probably all the same species here in this area.

Re: Embedding
By: Byrain
2013-03-29 14:10:32 CDT (-0400)

Cool! I always wondered how to do this. :)

Embedding
By: Christian (Christian Schwarz)
2013-03-29 13:56:14 CDT (-0400)

yeah I need to scope one of mine from a potted plant early last fall…

Also, if you write your observation number with underscores on both sides and observation in front of the number, it will embed the link automatically.

"_"observation 69038"_" (minus the quotation marks, of course)
becomes
observation 69038

Pholiotina with potted plants
By: Byrain
2013-03-29 12:56:39 CDT (-0400)

Thanks! This is the third year in a row I have seen Pholiotina with potted plants in a small area, two I have collections of. My other collection is observation 69038 which I hope to scope eventually.

Real neat fungus
By: Christian (Christian Schwarz)
2013-03-29 11:33:28 CDT (-0400)

Good documentation. I’ve never seen one like this that I can remember…

Created: 2013-03-29 11:18:54 CDT (-0400)
Last modified: 2016-06-24 15:20:55 CDT (-0400)
Viewed: 213 times, last viewed: 2016-11-17 01:11:43 CST (-0500)
Show Log