Observation 139330: Gymnopilus allantopus (Berk.) Pegler
When: 2013-07-08

Notes: Small to medium sized fungi growing on wood. Spore colour light brown. Three specimens on dead branch.Largest specimen pileus 2cm. Spore easil collected.

Proposed Names

-28% (3)
Recognized by sight
73% (3)
Eye3 Eyes3
Recognized by sight: pileus covered in fibrillose veil remnants, white basal mycelium
14% (3)
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS
By: Richard and Danielle Kneal (bloodworm)
2015-02-01 06:39:42 CET (+0100)

CATTATTGAATAAACTTGATGTGGTTGTAGCTGACTCTCTCGAGAGTATGTGCTCGCTCGTCATCTTTATCTTTCCACCTGTGCACTTCTTGTAGATTTGGATGTAGCTTTCCGAGGTAACTCGGTCGGGAGGAATGTCAACTCTTGTTGACTTTCCTTGTATGTCCAAGTCTATGTTTTTATATACTCCAATGAATGTAACAGAATGTATCACTGGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTACTAGTTTTTATAAGCTATGTAAATGGCTTGGATGTGGAGGTCTGCTGGTTTTGAAAAAGATCAGCTCCTCTTAAATGCATTAGCCGGTGCCCTGCGTGGACTGTCTATTGGTGTGATAATTATCTACGCCGTTAGATGTCTGCTATTAAATGGGATGCACTGCTTCTAATCGTCCTTCTAGGACAATCATTGACTATTTGACCTCAAATCAGGTAGGACTACCCG

sorry, it was a 99% match with Rees’s paper entitled “Relationships between australian and northern hemisphere Gymnopilus…”

thank you, Ian [edited]…
By: Richard and Danielle Kneal (bloodworm)
2015-01-31 03:47:03 CET (+0100)

for being a great member of this website and “community.”

a person who is actually truly trying to learn and observe what is around them is very rare…

instead we have people speculating about what they “think” MIGHT be true…

at any rate…
observation “#139077 [edit]” got very moldy and smells like fish (??). lol. i have no idea why.

ill see if i can stomach the smell and do micro on it. ;)

also, thank you for the opportunity to look at these. it is very much appreciated. i learned a lot and it will help a ton in the future.

Congrats

It is certainly a bit hard to beat Two +’s. Congrats on the suggested ID and the qualifying match up. Thanks for the relayed info. Makes work fun. kk

Gymnopilus allantopus…
By: Richard and Danielle Kneal (bloodworm)
2015-01-31 01:29:48 CET (+0100)

100% DNA match. i’ll post the ITS sequence tomorrow.

Micrographs

Wow! I am impressed. Kind Regards, kk.

dextrinoid spores…
By: Richard and Danielle Kneal (bloodworm)
2014-04-02 22:55:14 CEST (+0200)

@ 1000×...

micro…
By: Richard and Danielle Kneal (bloodworm)
2014-04-02 14:29:38 CEST (+0200)

sorry for the delay Ian.
will post more momentarily…

cystidia @ 400×.

cheilocystidia @ 400x w/ brown cell contents

cheilocystidia @ 1000x w/ measurements (25.8 × 4.8 × 3.7)

spores @ 1000x

pileipellis @ 400x

Created: 2013-07-10 03:57:16 CEST (+0200)
Last modified: 2015-01-31 02:15:11 CET (+0100)
Viewed: 174 times, last viewed: 2016-05-26 08:31:40 CEST (+0200)
Show Log