Observation 142650: Morchella frustrata M.Kuo
When: 2013-08-05
( 2900m)

Notes: Found under Pinus and Abies religiosa in an area which had been burned approximately one year prior.

ITS sequence: (its1f and its4 primers)

GAACATGAGCGAGGGATCGCGCTCGCGCTGGGCTCGATAGACGCGCTAGCACCCGTCAGGCCCGGAGGGCGAACCAGGCCCCTGGGGCCGGCAGGTTAAACCCAAGGTACCCATCCAAGGTGGACAGTCCTCCCAGAGTTCGCCCTTCGGCGTCTGCGAGCCATCGGGGCATGGAACCTTGGGGGCTGTCGGTTTCCCGCTGGGCATACGTCCGATGCCGCCTCGGGGAGCGAAACGTGGCTCGCGCAGCGTCGCAGCGTTGGTCCCCCACTCACTCACCAAAACCCTCTGCGTACCTTGCCCACTTGCTTCCCCCGGCCCTCCCGGCCGGGGGGCGACACCAAAAACCAAACTCTTTGCGATGAACCGACGTCTGAATGCCAAAAGCAAAACAAAAACAGTTAAAACTTTCAACAACGGATCTCTTGGCTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATAAAACCCCCTCCCCCTCGGATTAAATGTTCCTTGGGGGGTATTGGCCAATGGGATTGCGAGATAGCAATTGTTACCCAGGCGCCCAAATGCATCAGTACCCCGCCATTTACAGATTTACCAGCACCGAGGCCGTCAACCGTGGAGTTATGGGAATTATAGGCTTGCAGTAATATGCTCACCTCTCTCCATACGCAGGCGGCACACCGGGTAGAGTCGCGGGCGTAAAGCGGAATCCGAAACGGCCCTCACGGGTAGAGGAGGATCCTTGCGGGCTAGTCACCCCTCATCACAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCA

Images

357538
IMG_0299.JPG
357535
IMG_0305.JPG
357536
IMG_0303.JPG
Cross section
357537
IMG_0302.JPG
357539
IMG_0298.JPG
357540
IMG_0292.JPG
357541
IMG_0293.JPG
Young fruit bodies are gray
357542
IMG_0296.JPG

Proposed Names

87% (1)
Eye3 Eyes3
Recognized by sight: ITS DNA sequence matches 100% with Morchella frustrata sequences, and 99% with Morchella tridentina from Europe.
29% (1)
Based on chemical features: The North American M. frustrata is close to the European M. tridentina, but has several consistent base pair differences.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2013-08-14 13:09:16 PDT (-0700)
Last modified: 2016-06-11 11:23:56 PDT (-0700)
Viewed: 47 times, last viewed: 2016-06-16 22:48:50 PDT (-0700)
Show Log