Observation 144260: Macrolepiota colombiana group

Images

362746
IMG_5971.JPG
362741
IMG_5956.JPG
362742
IMG_5957.JPG
362743
IMG_5961.JPG
362744
IMG_5964.JPG
362745
IMG_5965.JPG
362747
IMG_5976.JPG
362748
IMG_5992.JPG
Habitat
625655
macrolepiota.JPG
ITS tree

Proposed Names

29% (1)
Recognized by sight
87% (1)
Eye3 Eyes3
Based on chemical features: ITS sequence is 97% similar to Macrolepiota columbiana

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
What a beautiful image!
By: Judi T. (AvidAmateur)
2016-08-06 22:18:11 CDT (-0500)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-12 08:24:01 CDT (-0500)

CTTGATGGGTTGTAGCTGGCTCTTCGGAGCAATGTGCACGCCTGTCTTGCTTTTTATTCATCCACCTGTGCACTTTCTGTAGTCTTCTAGGGATTGAGAGCAGCCAATTATCGAGCCTTCTCGGATGTGAGGGATGCTTGCGCGTAAAAGTGTGTAGCTTTCTTCAAATGGCTGTGAACTTTTCCTGGAGTCTATGTTTTCATATACCACATAGTATGTATCAGAATGTATTCAATGGGCCTTTTGTGCCTATAAATGATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCCCCTCCAATTTTGTATTGTGATGGGGCTTGGATATGGAGGTTTGCTGGCCTTTAAAAGGTCAGCTCTTCTGAAATGTATTAGCGGAACCGTTTGCGATCCGTCACAGGTGTGATAATTATCTACACCGTGTGGTCGCTCTCTGTCTGTTCAGCTTCTAATCGTCCTGTCTTCATGGACAATCATTTTGAATATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAG

Created: 2013-08-31 03:35:24 CDT (-0500)
Last modified: 2016-08-06 19:20:57 CDT (-0500)
Viewed: 64 times, last viewed: 2016-10-23 06:02:02 CDT (-0500)
Show Log