Observation 154578: Gymnopilus P. Karst.
When: 2013-10-20

Notes: Found on a fresh mulch bed around a small street tree in Greenbelt, MD on a sunny day, 10/20/13, with no other plants or fungi surrounding the specimen. The cluster contained ~8 semi-mature fruiting bodies and sat on a large 5 inch meaty section of the fungi. 4 in of the section was underground. The fruiting bodies were 2 in tall for the largest one. There were a number of tiny mushrooms at the bases of the other larger mushrooms. The caps and stipes were orange/tan, the gills were darker orange, and the spores that were on the partial veil were dark orange, while the inside was a yellowish/white flesh. When bruised, the exterior surface turned dark orange. The cap of the largest specimen was an 1 in wide and 0.3 in tall. The stipe was 1.75 inch tall and bulged 1/3 of the way up the base. The stipe was 0.5 in wide at the top and 0.75 in wide at the site of the bulge. The partial veil was thick and intact and seemed to collect some of the spores, and also was still fully covering the gills on some of the smaller mushrooms. The stipe was very smooth and the striations were vertical. The cap was smooth with what seemed like slight patches of darker orange color but were not raised. The gills were attached and had a darker orange color especially at the ends of them. The gills did not run up or down the stipe, they went horizontally to it. As I cut open the specimen at the bottom area, it was riddled with larvae and was eaten out from the inside. Some fruiting bodies also had signs of larvae inside of them.

Images

390132
IMG_3281.JPG
389894
IMG_3284.JPG
389895
IMG_3286.JPG
389896
IMG_3289.JPG
391555
IMG_3291.JPG
391556
IMG_3292.JPG
391557
IMG_3294.JPG
391563
DNA_Gym_jun.png

Proposed Names

2% (2)
Eye3
Used references: mushroomexpert.com
55% (1)
Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
95%…
By: Richard and Danielle Kneal (bloodworm)
2013-12-13 19:44:40 CET (+0100)

not a very good match.

if you can send some of this material to me, i would appreciate it.
email: bloodwormfungi@gmail.com

Oops
By: Byrain
2013-12-13 18:54:15 CET (+0100)

I pressed the “paste test sequence” thinking it did something else…

Check uploaded picture
By: Ilan Segal (isegal)
2013-12-13 18:52:03 CET (+0100)

I have uploaded another picture showing where the copy/pasted segment should go, where you press submit and what buttons should be highlighted. The buttons should already be previously highlighted though so you shouldn’t need to. Please let me know if this works.

Illan
By: Byrain
2013-12-13 18:35:06 CET (+0100)

I followed your directions and its telling me its Tomentella lateritia…
Maybe you can help me understand where I’m going wrong?

Fixed
By: Ilan Segal (isegal)
2013-12-13 18:21:19 CET (+0100)

I edited the previous comment, let me know if it doesn’t work.

Ilan…
By: Richard and Danielle Kneal (bloodworm)
2013-12-13 18:11:09 CET (+0100)

that link is not working for me…

DNA Analysis
By: Ilan Segal (isegal)
2013-12-13 18:08:09 CET (+0100)

And I actually did DNA analysis on it.
Go here, http://unite.ut.ee/analysis.php, and if you paste this into the box on the right and hit submit in the blastn area, you can look at the findings.
here’s what you copy/paste: NNNNNNNNNNCGNNNGGTCTTNNTGNTAACTTGACGNGGTGNAGCTGACTCTCGCAAGAGAGATGTGCTCGCCCGTTACC
TTTATCTTTCCACCTGTGCACTTTTTGTAGATTTGAATTGTGACTTTCCGAGGCAACTCGGTTGGGAGGAATGTCATTCG
TGGCTTTTCTTGTAATACGTTCAAGTCTATGTTTTCATATACTCCAAAAATGTAACAGAATGTATCATTGGGCCTTGTGC
CTGTAAACTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAA
TGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTT
TGAGTGTCATTTAATTCTCAGCCTTATTACNCATTTNGCTTCTANTGNCTGGATGTGGGGGTCTTTGCTGGNTTTGCAAG
AAATCTGCTCCCCTTAAATGTATTAGCCGGNCCCTACGTGGACTGTCTATTGTGTGATAATTATCTACGCCGTTAGATGT
CTGCTTTAAATGGGANGCGCTGCTTNCTAATCGTCTTTTAAGGACAATTATTNNCCATTTTGACCTCAAATCAGGTAGGA
CTANCNCGCTGAACTTAAGCATATCATANGGGGGAGGAA

In reply to Richard:
By: Ilan Segal (isegal)
2013-12-13 18:03:58 CET (+0100)

I do still have the dried material, and the stipe was firm but somewhat eaten by larvae. I’ll post some pictures of that, in fact, I’ll just post all of my pictures of it onto here.

Ilan…
By: Richard and Danielle Kneal (bloodworm)
2013-12-11 07:23:35 CET (+0100)

do you have dried material?
were the stipes hollow or firm in mature specimens?

Created: 2013-12-09 19:06:49 CET (+0100)
Last modified: 2013-12-11 07:25:07 CET (+0100)
Viewed: 123 times, last viewed: 2016-11-24 09:18:30 CET (+0100)
Show Log