Observation 155465: Xylaria apiculata Cooke
When: 2013-12-05
No herbarium specimen

Notes: Collected by Sydney (last name unknown) for Roo Vandergrift at the 2013 Four-University Albion Foray. Cajoled into my possession for posting here and deposit at SFSU. Collector had no substrate, specific locational, or habitat details to offer.

Dominant trees of the area:

Coastal Redoowd (Sequoia sempervirens), Douglas Fir (Pseudotsuga menziesii), Grand Fir (Abies grandis), Western Hemlock (Tsuga heterophylla), Bishop Pine (Pinus muricata), Tanoak (Lithocarpus densiflorus), Alder (Alnus spp.), Pacific Madrone (Arbutus menziesii) and California Bay Laurel (Umbellularia californica).

Microscopy forthcoming.

Proposed Names

58% (1)
Eye3
Recognized by sight
76% (1)
Eyes3
Recognized by sight: The spore size is actually intermediate between X. venosula and X. apiculata. I go with X. apiculata because of the nearly spore-length germ slit, and the ITS DNA sequence.
Based on microscopic features: Ascospores (20.8-) 21.6 (-23.5) by (6.5-) 7.9 (-8.5) with germslit straight, 80-90% of spore length, on flat side.
Based on chemical features: ITS1-5.8S-ITS2 rRNA gene sequence:
CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCAT
TAAAGAGTTATTACAACTCCCAAACCCATGTGAACATACCTTCTGTTGCCTCGGCAGGTCTGCAGC
TTACCCTGTAAGCCCCCCTACCCTGTAGGGGTCTTACCCGGTAGTTGCAGGTAAAGCCTGCCGGTG
GTCTACTAAACTCTGTTTATTATGTTATTCTGAATACTATAACTAAATAAGTTAAAACTTTCAACAAC
GGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAAT
TCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGA
GCGTCATTTCAACCCTTAAGCCCCTGTTGCTTAGCGTTGGGAGCCTACAGAAAACACTTCCGTAGCTC
CTCAAAGTCAGTGGCGGAGTCGGTTTCACACTCTAGACGTAGTAATTTTTATCTCGCCTATAGATGAG
CCGGTCCCCTGCCGTAAAACCCCCTAATTTCTAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTG
AACTTAAGCATATCAATAAGCGGAGGA

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Well…
By: Roo Vandegrift (Werdnus)
2016-07-01 16:46:25 PDT (-0700)

It’s complicated. Xylaria apiculata is part of a pretty big species complex, which also includes X. venosula, X. xylarioides, X. arbuscula, and many others. Macromorphology will get you to the group, usually called apiculata-group or arbuscula-group, but you need the microscopy to get it to species within the group.

I’d love to see some examples from Down Under! The closest I’ve gotten to working with material from there has been Taiwan, which I’m sure is pretty different.

So, Roo
By: Debbie Viess (amanitarita)
2016-07-01 13:26:03 PDT (-0700)

how much macro-morphological diversity is there within a Xylaria species? These “apiculata” from Mendo look very different from the far more slender, pinched over-all like beads on a string form that I found recently in Australia.

Is it really ALL about the micro, instead? And I suppose that you area also running DNA, just to get the stability of that three-legged stool?

I did not collect any from OZ, but I could ask my friend Ian to go back and get some for you. Might be interesting to see if all of these purported “apiculata” sp. really match up.

I did bring home two other interesting, unknown to me Xylaria collections from OZ, tho. Will post soon, and I can do the micro, first.

just found this
By: Danny Newman (myxomop)
2016-06-30 23:19:36 PDT (-0700)

or something very similar in Arkansas, complete with sterile, “pinched” apices (like the twisted ends of a tootsie roll) and vertically elongated cracks in the stromatal surface. collection en route to you soon, Roo.

Oh yeah!
By: Roo Vandegrift (Werdnus)
2016-06-29 15:18:14 PDT (-0700)

It was Dr. Glassman — not sure why that didn’t make it into the discussion somewhere. I still have the specimen, and will deposit it in the herbarium at OSU with my next big batch of stuff, whenever I get a bit of organizing time. Thanks for getting that in there!

It IS usually a tropical/subtropical species, but not unknown from more northern latitudes. I will bet that we start to see a shift in fungal ranges with climate change, though, particularly as precipitation regimes change.

just to update your obsie
By: Debbie Viess (amanitarita)
2016-06-29 15:06:03 PDT (-0700)

it was probably Sydney Glassman from UCB, now Dr. Sydney Glassman, I do believe, who made this original collection.

apiculata, in Mendocino? that’s a surprise. I though that it was a tropical/subtropical Xylaria?

Global warming ain’t that bad up there, at least not yet!

not sure
By: Danny Newman (myxomop)
2015-03-10 11:00:40 PDT (-0700)

if SFSU is equipped to store cultures. nor do I think the herbarium will terribly miss this collection, not when it’s already in the hands of as skilled a Xylariologist as yourself.

do feel free to forward me the micrographs if/when they become available and I’ll add them to the ob.

Photos
By: Roo Vandegrift (Werdnus)
2015-02-12 20:33:04 PST (-0800)

I’ve got good slides, and an archived culture of this fungus. Getting good dissecting microscope photos of the stromata and good photomicrographs is on my list, but it’s not got top priority yet. It’ll get there yet.

Danny, when I do send it back (probably not till Spring, if I’m honest with my work timeline), do you want a tube of viable culture with it?

Created: 2013-12-12 00:22:59 PST (-0800)
Last modified: 2015-02-12 20:30:03 PST (-0800)
Viewed: 124 times, last viewed: 2016-12-07 20:51:20 PST (-0800)
Show Log