Observation 156847: Amanita sect. Phalloideae (Fr.) Singer
When: 2013-09-20

Notes: This observation refers to the larger species which turns pink at maturity and barely stains yellow at all in KOH.

In the same place there is a smaller species with a more slender stem which stains bright yellow in KOH. http://mushroomobserver.org/156848

Some of the photos include both species.

Under pine in Los Cipriscitos.

Images

395334
IMG_7762.JPG
395328
IMG_7742.JPG
Both species
395329
IMG_7743.JPG
Both species
395330
IMG_7746.JPG
Both species
395331
IMG_7747.JPG
Both species
395332
IMG_7754.JPG
Gills turning pink in age
395333
IMG_7761.JPG
395335
IMG_7763.JPG
With KOH
395336
IMG_7765.JPG
395337
IMG_7766.JPG
395338
IMG_7767.JPG
Cross section
395339
IMG_7768.JPG
With KOH

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
LSU sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-24 12:25:25 EDT (-0400)

CTTGGTGGTAGTAAGATGCTTGGAGTGAATGTCCTGCTAGCGGGCACGCGCGACGTGGGTACTGATCTTGGTGGTATTAANTCTTGGCACGAATTGGATGAGCGGGCGAATGAAACACTTTGGGGATGCCCTGGAACTAGTCAAACATGACTTCCAATGGATTGAATATAGAGGACAACCTTTTTTTGTTTGCAATATCTTGGTGGTACTAATCAATGCCAGGAACAATGTTAGTTCTCTCTGCTGTCTAACTGTCTGTAAAAATGGACAACTTGACCAACTTGACTTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGATGTTTGTCTGTCTGAGTTGTAACCTAGAGAAGTGTAACCTGTGCTGGACCATGTACAAGTCTCCTGGAATGGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACATGGACTACCAGTGCACTGTGGTTACACACTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGCTGCATTGGCTGGGGATCAAGCCAGCTTATTTGCTGGGTGTACTTCCTGGTTGATGGGCCAACATCAGTTTTGACCATCAGAGAAAGGCTAAGGGAATGTGGCACCTTTATAGGTGTGTTATAGCCCTTGGTTGTATGTGGTGGTTGGGACTGAGGACAGCAGC

Created: 2014-01-01 01:23:28 EST (-0500)
Last modified: 2014-01-01 01:39:01 EST (-0500)
Viewed: 27 times, last viewed: 2016-10-27 20:15:59 EDT (-0400)
Show Log