Observation 15815: Psilocybe allenii Borov., Rockefeller & P.G. Werner
When: 2008-12-28
No herbarium specimen

Notes: Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTC
CTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGGAACTGGATAGGAGAGG
GACTTGTCCTTCAAGTTGAAG

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS gene
By: Alan Rockefeller (Alan Rockefeller)
2010-09-28 02:02:44 EDT (-0400)

The ITS gene is being sequenced. Geneious is being used to turn the raw data into nucleotides.

What gene is being sequenced here?
By: Paul Derbyshire (Twizzler)
2010-09-27 01:36:58 EDT (-0400)

And what tools are you using?

Created: 2008-12-29 02:18:05 EST (-0500)
Last modified: 2012-12-10 05:52:33 EST (-0500)
Viewed: 371 times, last viewed: 2017-07-24 23:23:16 EDT (-0400)
Show Log