Observation 15815: Psilocybe allenii Borov., Rockefeller & P.G. Werner
When: 2008-12-28
No herbarium specimen

Notes: Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTC
CTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGGAACTGGATAGGAGAGG
GACTTGTCCTTCAAGTTGAAG

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS gene
By: Alan Rockefeller (Alan Rockefeller)
2010-09-28 01:02:44 CDT (-0500)

The ITS gene is being sequenced. Geneious is being used to turn the raw data into nucleotides.

What gene is being sequenced here?
By: Paul Derbyshire (Twizzler)
2010-09-27 00:36:58 CDT (-0500)

And what tools are you using?

Created: 2008-12-29 01:18:05 CST (-0600)
Last modified: 2012-12-10 04:52:33 CST (-0600)
Viewed: 361 times, last viewed: 2017-01-19 14:36:45 CST (-0600)
Show Log