Observation 15815: Psilocybe allenii Borov., Rockefeller & P.G. Werner
When: 2008-12-28
No herbarium specimen
0 Sequences

Notes:
Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTC
CTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGGAACTGGATAGGAGAGG
GACTTGTCCTTCAAGTTGAAG

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS gene
By: Alan Rockefeller (Alan Rockefeller)
2010-09-27 23:02:44 PDT (-0700)

The ITS gene is being sequenced. Geneious is being used to turn the raw data into nucleotides.

What gene is being sequenced here?
By: Paul Derbyshire (Twizzler)
2010-09-26 22:36:58 PDT (-0700)

And what tools are you using?

Created: 2008-12-28 23:18:05 PST (-0800)
Last modified: 2012-12-10 02:52:33 PST (-0800)
Viewed: 380 times, last viewed: 2017-10-28 11:24:09 PDT (-0700)
Show Log