Observation 15815: Psilocybe allenii Borov., Rockefeller & P.G. Werner

When: 2008-12-28

Collection location: Mountain View, California, USA [Click for map]

Who: Alan Rockefeller (Alan Rockefeller)

No specimen available

Notes:
Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTC
CTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGGAACTGGATAGGAGAGG
GACTTGTCCTTCAAGTTGAAG

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS gene
By: Alan Rockefeller (Alan Rockefeller)
2010-09-28 02:02:44 CDT (-0400)

The ITS gene is being sequenced. Geneious is being used to turn the raw data into nucleotides.

What gene is being sequenced here?
By: Paul Derbyshire (Twizzler)
2010-09-27 01:36:58 CDT (-0400)

And what tools are you using?

Created: 2008-12-29 02:18:05 CST (-0500)
Last modified: 2018-01-30 21:48:54 CST (-0500)
Viewed: 392 times, last viewed: 2018-02-25 01:53:36 CST (-0500)
Show Log