Observation 161869: Inocybe (Fr.) Fr.
When: 2013-07-04
Collection location: Bangladesh [Click for map]

Notes: DNA match with DED8060 http://www.ncbi.nlm.nih.gov/nuccore/GQ893010.1

Collected by মোঃ ইকবাল হোসেন
ITS sequence: TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAATAAACTTGAACAGGCTGTTG
CTGGCCCCTCTGTGGGTATGTGCACGCTTGTCATCTTTATTTCTCCAACTGTGCACATAATTGTAGAC
TCTATAGAAAGCTTTTATTGGTTTAACAATAGATTGAGGATTAGTTCAAACTTTTCCTTGGACTTTCT
AGGTCTATGTTATTTTCATAAACCATGAAATGTGTTTTAGAATGTTGTAAATTTGAAAATGTATACAA
CTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA
ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCCTGGTATTCCTAGGAGCAT
GCCTGTTTGAGTGTCATTAAAATCTCAACCACAAGCTTGCTTGTGGATTGGATTATGGGAGTTTTTTT
GCAGGCTTTTAACAAAGTTGGCTCTCCTGAAATGCATTAGTAGTATCTGAGCAGACTACAGGTGTTGA
TAAATATTTTTTACACTTGAAGTTAGACTGCTATAACAGATTAGACTGCTTCAAAC

Images

410547
IMG_4692.JPG
Pleurocystidia 400x
410537
IMG_4682.JPG
Cheilocystidia 200x
410538
IMG_4683.JPG
Cheilocystidia 400x
410539
IMG_4684.JPG
Cheilocystidia 400x
410540
IMG_4685.JPG
Cheilocystidia 400x
410541
IMG_4686.JPG
Cheilocystidia 400x
410542
IMG_4687.JPG
Cheilocystidia 400x
410543
IMG_4688.JPG
Cheilocystidia 400x
410544
IMG_4689.JPG
Spores 400x
410545
IMG_4690.JPG
Spores 400x
410546
IMG_4691.JPG
Basidia 400x
410548
IMG_4693.JPG
Pleurocystidia 400x
410549
IMG_4694.JPG
Pleurocystidia 400x
410550
IMG_4696.JPG
Pleurocystidia 400x
410551
IMG_4697.JPG
Pleurocystidia 400x
410552
IMG_4701.JPG
Spores 1000x
416641
IMG_3773.JPG
416642
IMG_3775.JPG
416643
IMG_3777.JPG

Proposed Names

29% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
nice micro…
By: Richard and Danielle Kneal (bloodworm)
2014-03-22 11:51:35 PDT (-0700)

unreal!!

Seems
By: Irene Andersson (irenea)
2014-03-22 10:09:38 PDT (-0700)

not too different from Inocybe calospora – AM882759

Created: 2014-03-22 06:43:15 PDT (-0700)
Last modified: 2014-04-24 02:27:06 PDT (-0700)
Viewed: 55 times, last viewed: 2016-11-03 16:05:51 PDT (-0700)
Show Log