Observation 162079: Penicillium melinii Thom

Notes:
Collection # O-77, cultured by Alex Smith.

Species Lists

Images

411172
IMG_4964.JPG
411173
IMG_4963.JPG
411174
IMG_4970.JPG
600x in water
411175
IMG_4971.JPG
600x in water
411176
IMG_4973.JPG
200x in lactoglycerol
411177
IMG_4974.JPG
600x in lactoglycerol
411178
IMG_4975.JPG
600x in lactoglycerol
411179
IMG_4976.JPG
600x in lactoglycerol

Proposed Names

29% (1)
Recognized by sight
58% (1)
Eye3 Eyes3
Based on chemical features: Closest ITS match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-11-21 10:48:07 CST (-0600)

GATTGATTGTTGTCGGCAAGCGCCGGCCGGGCCTACAAGAGCGGAAGACGAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAAGGAGGACGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTTAGCTAATTGCTCAGACTGCAATCTTCAGACAGCGTTCAATGGTGTCTTCGGCGGGCGCGGGCCAGAGGGCAAAAGCCCCCCGGCGGCCGTGAGGCGGGCCCGCCGAAGCAACAAGGTACGATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTA

Created: 2014-03-25 18:14:06 CDT (-0500)
Last modified: 2018-03-08 22:08:17 CST (-0600)
Viewed: 78 times, last viewed: 2018-04-06 23:21:49 CDT (-0500)
Show Log