Observation 162079: Penicillium Link
When: 2013-03-25

Notes: Collection # O-77, cultured by Alex Smith.

Images

411172
IMG_4964.JPG
411173
IMG_4963.JPG
411174
IMG_4970.JPG
600x in water
411175
IMG_4971.JPG
600x in water
411176
IMG_4973.JPG
200x in lactoglycerol
411177
IMG_4974.JPG
600x in lactoglycerol
411178
IMG_4975.JPG
600x in lactoglycerol
411179
IMG_4976.JPG
600x in lactoglycerol

Proposed Names

87% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-11-21 11:48:07 CST (-0500)

GATTGATTGTTGTCGGCAAGCGCCGGCCGGGCCTACAAGAGCGGAAGACGAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAAGGAGGACGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTTAGCTAATTGCTCAGACTGCAATCTTCAGACAGCGTTCAATGGTGTCTTCGGCGGGCGCGGGCCAGAGGGCAAAAGCCCCCCGGCGGCCGTGAGGCGGGCCCGCCGAAGCAACAAGGTACGATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTA

Created: 2014-03-25 19:14:06 CDT (-0400)
Last modified: 2016-11-21 11:46:58 CST (-0500)
Viewed: 34 times, last viewed: 2016-11-22 10:31:35 CST (-0500)
Show Log