Observation 163224: Tricharina praecox (P. Karst.) Dennis
When: 2014-03-13
(37.8126° -119.9128° 1259m)

Notes: Collected in the Rim Fire area on burnt ground. The ITS sequence (below) is a perfect match to the type Tricharina praecox var praecox except for the beginning of the beginning of the sequence that may be in error.

ITS: TCTTGGTCAATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGTAAATATGTATTCTCTGGAATATACGTTTCAAACCCATCTGTGTATCTTACCTGTTGCTTCCGTACCGCGTGGACTTCGGTCCCCTCATGCTGTACTTCGGTACGGTTCCAGAGTGCCGGTGCGGAAGGTATACATCAAACTCTTGCATTCCATGTCTTCTGTCTGAACTGTTAATAACAAAAGTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAAAAACCACTCAAGCTCTTTTGCTTGGTCATGGAAGAAGAGTCCGCTTGCCGGTCTCCCTTTCGAAATGCAATGGCGGAAGGTCTCTTGTACCCAGCGTAGTAATAACTTTTCGCTTTGTGCATTGATTCATTCCTGCCGTCAAACCCCCAATTTTCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

Proposed Names

83% (1)
Eye3 Eyes3
Based on microscopic features: spores and paraphyses match
Based on chemical features: ITS sequence

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-04-10 18:39:25 EDT (-0400)
Last modified: 2014-04-10 18:43:58 EDT (-0400)
Viewed: 61 times, last viewed: 2017-07-03 14:58:36 EDT (-0400)
Show Log