Observation 163224: Tricharina praecox (P. Karst.) Dennis

When: 2014-03-13

Collection location: Hardin Flat Rd., Stanislaus National Forest, Groveland, California, USA [Click for map]

37.8126° -119.9128° 1259m

Who: Tom Bruns (pogon)

Specimen available

Notes:
Collected in the Rim Fire area on burnt ground. The ITS sequence (below) is a perfect match to the type Tricharina praecox var praecox except for the beginning of the beginning of the sequence that may be in error.

ITS: TCTTGGTCAATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGTAAATATGTATTCTCTGGAATATACGTTTCAAACCCATCTGTGTATCTTACCTGTTGCTTCCGTACCGCGTGGACTTCGGTCCCCTCATGCTGTACTTCGGTACGGTTCCAGAGTGCCGGTGCGGAAGGTATACATCAAACTCTTGCATTCCATGTCTTCTGTCTGAACTGTTAATAACAAAAGTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAAAAACCACTCAAGCTCTTTTGCTTGGTCATGGAAGAAGAGTCCGCTTGCCGGTCTCCCTTTCGAAATGCAATGGCGGAAGGTCTCTTGTACCCAGCGTAGTAATAACTTTTCGCTTTGTGCATTGATTCATTCCTGCCGTCAAACCCCCAATTTTCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

Proposed Names

83% (1)
Eye3 Eyes3
Based on microscopic features: spores and paraphyses match
Based on chemical features: ITS sequence

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-04-10 18:39:25 CDT (-0400)
Last modified: 2014-04-10 18:43:58 CDT (-0400)
Viewed: 64 times, last viewed: 2018-02-18 07:16:10 CST (-0500)
Show Log