Observation 163764: Gymnopilus crociphyllus (Cooke & Massee) Pegler
When: 2014-04-19

Notes: Small redcapped fungi growing in soil. Two specimens in close proximity. Height about 4cm and cap about 2.5cm. Fungi was firm and without any detectable identifying aroma.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Ian…
By: Richard and Danielle Kneal (bloodworm)
2015-02-01 00:17:41 CST (-0600)

lol.

go here:

http://blast.ncbi.nlm.nih.gov/...

then copy and paste that sequence:

CATTATTGAATAAACCTGGCGTGGTTGTAGCTGGCTCTTTAGGGAGCATGTGCTCGCCCGTCATCTTTATCTTTCCACCTGTGCACTTCTTGTAGGTCTGGATGTAAACTTTCCGAGGCAACTCGGTCGGGAGGAATGTCAACTTTTGTTGGCTTTCCTTGTATGTCCAGGTCTATGTTTTCATATACTCCAAAGCATGTAACAGAATGTGTCTAAGGTCTTTGTGCCTTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACTAGCTTTTACTAGCTATGTAATGGCTTGGAAGTGGGGGTCTTTTGCTGGTTTCGCAAGAAGTCAGCTCCCCTAAAATGCATTAGCCGGTGCCCCGCGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTTAGATGTCTGCTATTAAATGGGATGTGCTGCTTCTAATCGTCCGTCTTGGACAATTAATGACTATTTGACCTCAAATCAGGTAGGACTAC

into the box underneath where it says, “Enter accession number(s), gi(s), or FASTA sequence(s).”

then click “BLAST” at the bottom.

Comment

Gotchya I think. ( my dictionary only goes to max 26 letters). who could or would argue. lol kk

ITS
By: Richard and Danielle Kneal (bloodworm)
2015-01-31 23:42:31 CST (-0600)

CATTATTGAATAAACCTGGCGTGGTTGTAGCTGGCTCTTTAGGGAGCATGTGCTCGCCCGTCATCTTTATCTTTCCACCTGTGCACTTCTTGTAGGTCTGGATGTAAACTTTCCGAGGCAACTCGGTCGGGAGGAATGTCAACTTTTGTTGGCTTTCCTTGTATGTCCAGGTCTATGTTTTCATATACTCCAAAGCATGTAACAGAATGTGTCTAAGGTCTTTGTGCCTTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACTAGCTTTTACTAGCTATGTAATGGCTTGGAAGTGGGGGTCTTTTGCTGGTTTCGCAAGAAGTCAGCTCCCCTAAAATGCATTAGCCGGTGCCCCGCGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTTAGATGTCTGCTATTAAATGGGATGTGCTGCTTCTAATCGTCCGTCTTGGACAATTAATGACTATTTGACCTCAAATCAGGTAGGACTAC

Gymnopilus crociphyllus…
By: Richard and Danielle Kneal (bloodworm)
2015-01-30 18:28:34 CST (-0600)

100% DNA match. i’ll post the ITS sequence tomorrow.

Ian…
By: Richard and Danielle Kneal (bloodworm)
2014-04-22 14:02:08 CDT (-0500)

that would be great if you can send these as well…
thank you.

Richard

I am about to load a small number of finds from today. If you would like this specimen(s) posted I can include them in your parcel. Please check todays loads, (finds), and then let me know your Obs numbers for me to check them off before sending. Thanks for the kind comments.

Outstanding!
By: Martin Livezey (MLivezey)
2014-04-21 20:06:35 CDT (-0500)

new to science!

Ian…
By: Richard and Danielle Kneal (bloodworm)
2014-04-19 21:54:44 CDT (-0500)

these are great!!

Created: 2014-04-19 21:12:54 CDT (-0500)
Last modified: 2015-02-01 05:09:46 CST (-0600)
Viewed: 154 times, last viewed: 2016-10-24 02:12:51 CDT (-0500)
Show Log