Observation 164919: Morchella sextelata M. Kuo
When: 2014-05-08
( 4500m)

Notes: Growing in an area burned by the rim fire. Thousands of fruit bodies seen, all were near Abies concolor.

LSU consensus sequence (two fruit bodies sequenced with 5.8sr and LR7 primers)

GGTGGTAGGAAGATAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGATCTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGCAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGCCACGGTAGMAACGATGCCGTGGCGAGTAGGCAGGCGTGGGGGTCAGTGACGAAGCCTTGGGAGTGATCCCGGGTCGAACGGCCCCTAGTGCAGATCTTGGTGGTAGTAANNACGTCACAGAGGGTGAGAATCCCGTGCTTGGCTGGCTGTCCCCGTCCATGTGAGGTGTCTTCSACSAGTCSAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAANATGAAAAGCACTTTGAAAATAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAGACCAGACTTCGGTAGGGGGTGATCAGCCGTGCTTCNNCGCGGTGCACTTGTTCCTCTCCGGGNCAGCATCNNTTGAGGCGGCGGGATAAAGGTCCCGGGAATGTGGCTCCNTCACGGGAGTGTTATAGCCCGGGNTGAATGCCGCCA

ITS sequence:

CGAGGTCAATTATGTATGGTGGATGCTAGGCCACGAGGGTCCTGAAGAGGACTCCAATTTACGCCCGCAACTGCGACCGGTGTGCCATCGGCGTATGGAGAAAGGTGAGCATTTTACTGCAAGCCTATATATCCCATAACTCCACGGTTGATGGCCTCGGTGCTGTCGCATCTGGAGGCGGGTCTACGTCTATTTAGGACATTGGGAAACTAATTGCCAATCGCTATCCCATTAGGCCAAAACCCCCCAACGATAGTAATCAAACCCGAAGGGGGAGGAGGTTTTTATGACGCTCGAACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGTGGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTTTTTTTGTTTTTGTAATTCTGACGTCTGTTTGTTCACAAAGAGTTTTGGTTGTTGTTCCTCCCCCCAGCGAGGTGCCGGGGGAAGCAAGGTGGGACAGGTACGCAGAGGGTTTAGATGGGGGCTGCCCCGGGTTCCTGGCAGGCCGTTCAACAACGTAAAGCTACTAGGCCTGCCGGCCCCCACAGGGCGGGGCCCTTTTCTGTGTGGTTCTTGGTAATGATCCTTCCGCAGGTTCACCTACGGAAG

Images

419386
IMG_5815.JPG
419387
IMG_5809.JPG
419388
IMG_5816.JPG
419389
IMG_5794.JPG
419390
IMG_5793.JPG
419396
IMG_5790.JPG
419397
IMG_5791.JPG
419398
IMG_5787.JPG
419399
IMG_5781.JPG

Proposed Names

92% (2)
Eye3 Eyes3
Based on chemical features: 100% ITS match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
LSU & ITS sequences added
By: Alan Rockefeller (Alan Rockefeller)
2014-06-21 09:34:08 CDT (-0500)
superb/elegant
By: Keith Buckley (zorel)
2014-05-09 02:27:10 CDT (-0500)

A unique look at the precious fruit during it’s early development.

Created: 2014-05-08 22:22:24 CDT (-0500)
Last modified: 2015-12-05 18:05:14 CST (-0600)
Viewed: 813 times, last viewed: 2017-04-14 22:54:04 CDT (-0500)
Show Log