Observation 164960: Morchella sextelata M. Kuo
When: 2014-05-09
( 5000m)

Notes: Under Abies concolor in the rim fire burn zone.

LSU consensus sequence (two fruit bodies sequenced with 5.8sr and LR7 primers)

GGTGGTAGGAAGATAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGATCTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGCAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGCCACGGTAGMAACGATGCCGTGGCGAGTAGGCAGGCGTGGGGGTCAGTGACGAAGCCTTGGGAGTGATCCCGGGTCGAACGGCCCCTAGTGCAGATCTTGGTGGTAGTAANNACGTCACAGAGGGTGAGAATCCCGTGCTTGGCTGGCTGTCCCCGTCCATGTGAGGTGTCTTCSACSAGTCSAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAANATGAAAAGCACTTTGAAAATAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAGACCAGACTTCGGTAGGGGGTGATCAGCCGTGCTTCNNCGCGGTGCACTTGTTCCTCTCCGGGNCAGCATCNNTTGAGGCGGCGGGATAAAGGTCCCGGGAATGTGGCTCCNTCACGGGAGTGTTATAGCCCGGGNTGAATGCCGCCA

ITS sequence:

CGAGGTCAATTATGTATGGTGGATGCTAGGCCACGAGGGTCCTGAAGAGGACTCCAATTTACGCCCGCAACTGCGACCGGTGTGCCATCGGCGTATGGAGAAAGGTGAGCATTTTACTGCAAGCCTATATATCCCATAACTCCACGGTTGATGGCCTCGGTGCTGTCGCATCTGGAGGCGGGTCTACGTCTATTTAGGACATTGGGAAACTAATTGCCAATCGCTATCCCATTAGGCCAAAACCCCCCAACGATAGTAATCAAACCCGAAGGGGGAGGAGGTTTTTATGACGCTCGAACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGTGGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTTTTTTTGTTTTTGTAATTCTGACGTCTGTTTGTTCACAAAGAGTTTTGGTTGTTGTTCCTCCCCCCAGCGAGGTGCCGGGGGAAGCAAGGTGGGACAGGTACGCAGAGGGTTTAGATGGGGGCTGCCCCGGGTTCCTGGCAGGCCGTTCAACAACGTAAAGCTACTAGGCCTGCCGGCCCCCACAGGGCGGGGCCCTTTTCTGTGTGGTTCTTGGTAATGATCCTTCCGCAGGTTCACCTACGGAAG

Images

419494
IMG_5842.JPG
No flash
419493
IMG_5853.JPG
A pizza with morels and miners lettuce
419495
IMG_5843.JPG
With flash
419496
IMG_5840.JPG
419497
IMG_5841.JPG
419498
IMG_5838.JPG
419499
IMG_5837.JPG
419517
IMG_5833.JPG
419518
IMG_5834.JPG
419519
IMG_5835.JPG
419520
IMG_5836.JPG

Proposed Names

92% (2)
Eye3 Eyes3
Recognized by sight: A black burn morel
Based on chemical features: 100% DNA ITS match with Morchella sextelata

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-05-09 22:55:40 CDT (-0400)
Last modified: 2015-12-05 23:01:30 CST (-0500)
Viewed: 245 times, last viewed: 2016-10-23 17:04:42 CDT (-0400)
Show Log