Observation 164960: Morchella sextelata M. Kuo
When: 2014-05-09
5000m
0 Sequences

Notes:
Under Abies concolor in the rim fire burn zone.

LSU consensus sequence (two fruit bodies sequenced with 5.8sr and LR7 primers)

GGTGGTAGGAAGATAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGATCTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGCAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGCCACGGTAGMAACGATGCCGTGGCGAGTAGGCAGGCGTGGGGGTCAGTGACGAAGCCTTGGGAGTGATCCCGGGTCGAACGGCCCCTAGTGCAGATCTTGGTGGTAGTAANNACGTCACAGAGGGTGAGAATCCCGTGCTTGGCTGGCTGTCCCCGTCCATGTGAGGTGTCTTCSACSAGTCSAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAANATGAAAAGCACTTTGAAAATAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAGACCAGACTTCGGTAGGGGGTGATCAGCCGTGCTTCNNCGCGGTGCACTTGTTCCTCTCCGGGNCAGCATCNNTTGAGGCGGCGGGATAAAGGTCCCGGGAATGTGGCTCCNTCACGGGAGTGTTATAGCCCGGGNTGAATGCCGCCA

ITS sequence:

CGAGGTCAATTATGTATGGTGGATGCTAGGCCACGAGGGTCCTGAAGAGGACTCCAATTTACGCCCGCAACTGCGACCGGTGTGCCATCGGCGTATGGAGAAAGGTGAGCATTTTACTGCAAGCCTATATATCCCATAACTCCACGGTTGATGGCCTCGGTGCTGTCGCATCTGGAGGCGGGTCTACGTCTATTTAGGACATTGGGAAACTAATTGCCAATCGCTATCCCATTAGGCCAAAACCCCCCAACGATAGTAATCAAACCCGAAGGGGGAGGAGGTTTTTATGACGCTCGAACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGTGGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTTTTTTTGTTTTTGTAATTCTGACGTCTGTTTGTTCACAAAGAGTTTTGGTTGTTGTTCCTCCCCCCAGCGAGGTGCCGGGGGAAGCAAGGTGGGACAGGTACGCAGAGGGTTTAGATGGGGGCTGCCCCGGGTTCCTGGCAGGCCGTTCAACAACGTAAAGCTACTAGGCCTGCCGGCCCCCACAGGGCGGGGCCCTTTTCTGTGTGGTTCTTGGTAATGATCCTTCCGCAGGTTCACCTACGGAAG

Species Lists

Images

419494
IMG_5842.JPG
No flash
419493
IMG_5853.JPG
A pizza with morels and miners lettuce
419495
IMG_5843.JPG
With flash
419496
IMG_5840.JPG
419497
IMG_5841.JPG
419498
IMG_5838.JPG
419499
IMG_5837.JPG
419517
IMG_5833.JPG
419518
IMG_5834.JPG
419519
IMG_5835.JPG
419520
IMG_5836.JPG

Proposed Names

92% (2)
Eye3 Eyes3
Recognized by sight: A black burn morel
Based on chemical features: 100% DNA ITS match with Morchella sextelata

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-05-09 19:55:40 PDT (-0700)
Last modified: 2015-12-05 20:01:30 PST (-0800)
Viewed: 260 times, last viewed: 2017-10-04 19:31:28 PDT (-0700)
Show Log