Observation 167663: Penicillium brevicompactum Dierckx

Notes:
Re: http://www.instructables.com/id/Backyard-Forensics/

ITS sequence:

TCCACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGAGCCTGCCTTTTGGCTGCCGGGGGACGTCTGTCCCCGGGTCCGCGCTCGCCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGACTGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA

Species Lists

Images

428669
IMG_5974.JPG
427250
penicillium-tree.jpg
428668
IMG_5973.JPG
428670
IMG_5975.JPG
428674
IMG_5977.JPG
483740
Penicillium.jpg
A better phylogenetic tree

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Published in Biocoder 6
By: Alan Rockefeller (Alan Rockefeller)
2018-02-24 23:08:45 EET (+0200)

Cataloging Strains:Isolation and Identification of Invasive Fungi on Citrus limon

Page 11

http://www.oreilly.com/...

Created: 2014-06-18 14:45:09 EEST (+0300)
Last modified: 2018-03-09 06:08:41 EET (+0200)
Viewed: 102 times, last viewed: 2018-05-02 13:51:06 EEST (+0300)
Show Log