Observation 167663: Penicillium brevicompactum Dierckx
When: 2014-06-18

Notes: Re: http://www.instructables.com/id/Backyard-Forensics/

ITS sequence:

TCCACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGAGCCTGCCTTTTGGCTGCCGGGGGACGTCTGTCCCCGGGTCCGCGCTCGCCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGACTGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA

Images

428669
IMG_5974.JPG
427250
penicillium-tree.jpg
428668
IMG_5973.JPG
428670
IMG_5975.JPG
428674
IMG_5977.JPG
483740
Penicillium.jpg
A better phylogenetic tree

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-06-18 15:45:09 MSK (+0400)
Last modified: 2014-11-20 18:19:25 MSK (+0300)
Viewed: 59 times, last viewed: 2016-10-26 13:05:34 MSK (+0300)
Show Log