Observation 168189: Boletus miniato-olivaceus Frost.
When: 2014-06-21
0 Sequences

Notes:
>> These specimens were collected along Toms Creek Trail (marker 6 or 7). The trail head begins from the picnic area at Egypt Mills Road connector road off US-209. Collected by Jack Barnett/Mary Anne Carletta in a habitat of predominantly hemlock intermixed with some hardwoods.
>> The larger basidiocarp (preserved) was no more than 3" tall and had a cap of up to 2.25" in diameter.
>> The caps were velvety to glabrous, NOT pitted or corrugated, orange-brown or orange-cinnamon (reminiscent of the cap color of _B. hortonii, only richer). I wouldn’t describe this color as red or some shade of red — it was more like brown diluted with red.
>> The pore surface was deep lemon yellow, with very small pores, slowly and very weakly staining blue (see pic). The bluing never faded or changed color
>> The stipes were paler yellow, minutely scruffy(under lens), with patchy areas of pinkish-red in the middle of the stipe (see pix). No bluing on the surface when handled or scratched.
>> The context (see pic) was reddish-brown under the cap cuticle, and variably yellow below to the tip of the stipe. Not even a hint of bluing was observed.

Macro-chemical Tests: KOH/NH4OH was negative or merely intensifying background color on context; FeSO4 was instantly bluish-gray on context (just like in hortonii); KOH or NH4OH (cannot recall) instantly gave red with a hint of purple, resolving into mustard yellow.

nrLSU sequence of MO168189:
AAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTTGAATCTGGCGGTCTTCGGCCGTCCGAGTTGTAATCTAGAGAAGCGTCTTCCGCGCTGGTCCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGTCCGGGGATCAACCTTGCTTCTCGCTGGGTGCATTTCCTGGTCAACGGGTCAGCATCAGTTTCCGTCGCCGTACAATGGCAAGGGGAACGTGGCACTCTTCGGGGTGTGTTATAGCCTCGTGTCGTATGCGGTGGTAGGGACTGAGGAACTCGGCATGACTTCGGTCTGTGTCTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGCCAAACCCAAGCGCGTAATGAAAGTGAAAGTCGAGACCTCTGTCATGGAGGGCATCGACGCCCGGACCTGAGTCTTTGACAAAGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCTCTTCATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCGTCAGCGTTCAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGTGAAGAAGCCTTGGCAGCAATGCTGGGTGGAACCGCCTCTAGTGC

DNA Sequencing Discussion:
> A clean and contiguous 1384 bps nrLSU sequence was obtained for this material (the first 59 bps from the start of the LSU region are missing).
> A GenBank BLAST search of the full-length sequence didn’t return any meaningful alignments.
> A GenBank BLAST search of a 919 bps sequence fragment returned the following top hits:
1) Boletus miniato-olivaceus #KF030243, 877/877 = 100%
2) Boletus smithii #KF030244, 868/877 = 99.0%
3) Gastroboletus vividus #KF030245, 849/858 = 99.0% identity match; accession #KF030245)
The three sequences were used in “Phylogenetic overview of the Boletineae” by Nuhn et al., Fungal Biol 2013, 117 (7-8), 479-511.
> Smithii and vividus appear to be the closest relatives of “mini-o” — see Noah Siegel’s comment below.

Species Lists

Images

428685
Auto mode with a flash; ISO-200; f/8; 1/60 sec; pattern metering
428686
Manual mode w/out a flash; ISO-400; f/4; 1/30; average metering
428687
Manual mode w/out a flash; ISO-400; f/4; 1/30; average metering
428688
Manual mode w/out a flash; ISO-400; f/4; 1/30; average metering.
Note the weak bluing on the pore surface; the color never faded or changed to brown
428689
Manual mode w/out a flash; ISO-400; f/4; 1/60; average metering.
No bluing at all, not even after half hour

Proposed Names

-28% (1)
Recognized by sight
85% (3)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Nice work, Igor.
By: Dave W (Dave W)
2016-01-28 04:56:56 PST (-0800)

It’s a good day when the DNA confirms what we believe to see.

DNA discussion posted
By: I. G. Safonov (IGSafonov)
2016-01-27 21:06:38 PST (-0800)

The nrLSU sequence obtained for this material is a perfect match to a B. miniato-olivaceus voucher in GenBank.

My collections of mini-o…
By: Dave W (Dave W)
2014-06-25 09:49:49 PDT (-0700)

have shown some variable bluing on the cut context, sometimes none at all, never quick or prominent. Also, many I have examined have color of context whitish, especially in the cap. Cotext in stipe is dull pale yellow. Here’s an obs from about a week ago. obs 167774

My take on the color change in the cap is that faded blothes are an olivaceous shade, which seems to be the origin of this part of the name.

This
By: Noah Siegel (Noah)
2014-06-25 06:22:36 PDT (-0700)

belongs in a small group that include B. smithii and a couple of western Gastroboletus. They most likely belong in their own genus.

The Orangish-pinkish-red, almost velvety cap that fades to grayish (in a spotty manner), yellow unstaining flesh, yellowish pores that slowly stain blue, and often become reddish blushed in age are distinctive for this group.

Thanks all!
By: Jack Barnett (wjbarnett)
2014-06-25 05:14:52 PDT (-0700)

I had no idea on this one. Thanks Igor, Noah & Dave!

Noah and Dave,
By: I. G. Safonov (IGSafonov)
2014-06-24 11:23:42 PDT (-0700)

Thank you for your input.
I had never collected “mini-o”, which explains why I was having difficulty in identifying this bolete. Association with the sensibilis group was not immediately obvious to me, as there was no bluing on the flesh and only a faint one on the pore surface.
Overall it fits the species concept in B-R-B, though there is no bluing action on the context and the macro-chemical tests on cut flesh are totally different.

Created: 2014-06-22 20:23:57 PDT (-0700)
Last modified: 2017-04-19 10:56:26 PDT (-0700)
Viewed: 169 times, last viewed: 2017-10-09 11:49:33 PDT (-0700)
Show Log