Observation 172409: Polyporus arcularius group
When: 2014-07-30
No herbarium specimen

Notes: Growing on hardwood near the big river below San Augustine.

Images

440714
IMG_9048.JPG
440712
IMG_9044.JPG
440713
IMG_9045.JPG
440715
IMG_9049.JPG
440716
IMG_9050.JPG
440717
IMG_9051.JPG
440718
IMG_9054.JPG
440719
IMG_9055.JPG
615385
polyporus.arcularius.tree.jpg

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
I see three clades of Polyporus arcularius
By: Alan Rockefeller (Alan Rockefeller)
2016-05-06 00:37:29 CEST (+0200)

Two have worldwide distribution and one is just in Asia. Which one is sensu stricto?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-05 21:27:52 CEST (+0200)

ACGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAGCGAGTGCTTAACCGCTCTCGCCGAGTTGTTACTGGGCCTACGTTTATCACAAACTCTTAAAGTATCAGAATGTAAACGCGTCTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAGTTCTTAACGGGACTTGCTTAGGCTTGGACTTGGAGGCTTGTCGGCTGCTTRGCAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCACGGTGTGATAATTATCTGCGCCGCGACCGTTGAAGCGTTTAATGGCCAGCTTCTAATCGTCTCTTGCGAGACAGCTTTCATCGAACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Ah ok
By: Elsa (pinknailsgirl)
2014-08-06 02:37:40 CEST (+0200)

now I got the point, thanks.

According to my DNA analysis
By: Alan Rockefeller (Alan Rockefeller)
2014-08-06 02:21:01 CEST (+0200)

of the sequences in Genbank, Polyporus arcularius from Costa Rica is the same as that from the USA, however the European sequences are different. Since Polyporus arcularius is a name from Europe, it probably can’t be applied in North America.

Since Polyporus tricholoma is a name from Cuba, it is more likely to be the correct species for this observation.

Polyporus arcularius
By: Elsa (pinknailsgirl)
2014-08-06 01:52:32 CEST (+0200)

is widely distributed in North America.

I think Polyporus arcularius is a European species
By: Alan Rockefeller (Alan Rockefeller)
2014-08-04 16:39:47 CEST (+0200)

Not sure if we get it in North America. I collected this so I could sequence it and find out.

Why not P. arcularius?
By: Elsa (pinknailsgirl)
2014-08-04 11:32:30 CEST (+0200)

Created: 2014-08-04 07:27:32 CEST (+0200)
Last modified: 2016-05-06 00:36:36 CEST (+0200)
Viewed: 99 times, last viewed: 2016-12-21 00:16:47 CET (+0100)
Show Log