Observation 179586: Boletus weberi group
When: 2014-09-12

Notes: > A family of four specimens growing on the grassy margin of a trail under pitch pine and blackjack oak saplings in the North Gate section of FPP near Bertha’s canal.
> This is the same mysterious bolete originally reported in obs 102459 and obs 143371.

Microscopic features (posted on 14-Jun-17):
[20/1/1]; mounted in 10% KOH;
L x W = 8.8-15.8 × 4.2-5.6 (-6.0) μm;
L’ x W’ = 12.6 × 5.0 μm;
The shortest single spore observed was only 7.4 μm long and the longest one was 17.2 μm long; both were viewed as “freaks” and neither was included in the measurements.
Overall the spores are prominently inequilateral in side-view (dorsi-ventral), slightly inequilateral in face-view (dorsal or ventral) and highly variable in shape (many spores very curvy and with a gradated width). The observed color is pale malachite green. The contents are multigutulate. This is the most unusual spore profile of any boletes I’ve look at through the scope and I wonder if this has to do with the age of the spore print (close to 3 years old).
Singer published B. weberi in Mycologia in 1945. The brief description is in Latin. The spore measurements given therein are 9-15.3 × 4-5.5 μm, which is very close to my own measurements. BENA gives 10-13 × 4-6 μm and describes the spores as narrowly ellipsoid to subfusoid and pale ochraceous.

DNA Sequencing Discussion (Updated & Edited 21-Mar-17):
> In the past attempts were made to get a nrITS sequence for obs 143371 (the original collection, obs 102459, has been in the custody of Dr. Roy Halling of NYBG since the 2012 NEMF Foray), but the effort was thwarted by a repeating nucleotide fragment that caused the ensuing sequence to be non-specific at a homopolymeric region. It was explained to me that since such motifs can vary in length and occur more that once (naturally, it doesn’t have to be the same nucleotide), the scrambling renders the sequence unreadable. The only way to overcome this intra-genomic variation problem is to run sequences for at least two collections (in case of one repeating motif) or to do cloning, the latter being expensive and labor intensive. However, later on, reconstruction of a full-length nrITS sequence from the various overlapping sequence fragments from the two collections became possible (the sequence had only one long homo-polymeric motif, “AAAAAA”).
Unfortunately, this full-length sequence of 735 nucleotides (posted in the comment below) did not match anything in GenBank and the generated hit list didn’t produce any meaningful leads (checked last time on 21-Mar-2017).
> Unfortunately and annoyingly, the intra-genomic variation problem also befell nrLSU. A short ‘excerpt’ of the central section of the sequence estimated to be ~50-bp long – based on the total length of the readable strings of characters up to the LR5 region (913 bases) and the typical length of this section for Boletaceae (963 bases) in my experience – is unreadable due to intra-genomic variation. The forward read (from the 5’ end) generated a 481-bps fragment; the reverse read (from the 3’ end) yielded a 915-bp fragment.
A BLAST search of the forward-read fragment did not return any meaningful hits.
Interestingly, a BLAST search of the first 432 characters of the reverse-read fragment (from where the sequence becomes specific again through to the LR5 region) gave Xerocomus aff. macrobbii [sic] voucher HKAS56280, a bolete collected in China, as the top hit. Though only 96.8% similar, it stood out because the 2nd top hit came at a ‘distant’ 95%. In my annotation of the ‘B. weberi group’ name proposal (vide infra), I indicate that X. mcrobbii is part of this complex (as per Ortiz-Santana et al., 2007).
Further research into HKAS56280 revealed that it was actually part of the broad phylogenetic analysis of the Boletaceae in Wu et al. (2014), and happens to be the sole representative of Clade 43, a sister clade to Pulveroboletus. There is a picture of this bolete in the paper. Dr. Roy Halling made a fresh collection of X. mcrobbii in Australia and posted it as obs 204748. Therein Dr. Halling writes: “O. Raspé (Belgium) has observed that this species likely belongs in Pulveroboletus based on the nature of the scales on the stipe and felty patches on the pileus (a peronate veil)”.

So, the DNA saga ends here for now, but ironically most progress on the identity of this interesting Pine Barrens find had been made via a fortuitous observation made by me on p. 170 of Boletes of Eastern North America. A picture is worth a 1000 words… and then some. :-)

Proposed Names

-57% (1)
Recognized by sight
57% (1)
Eye3 Eyes3
Recognized by sight: This taxon (represented by the three aforementioned collections made in the NJ Pine Barrens) is similar to Singer’s B. weberi (originally described from Fla), but there are differences. A further online search uncovered the so called ‘Boletus weberi complex’ consisting of weberi itself and B. rubropictus (North America) and B. guatemalensis (Mesoamerica). Boletus granulopunctatus (Japan) and Xerocomus mcrobbii (New Zealand) appear to be related morphologically. The whole morpho-clade has a unique gestalt look about it.
Used references: 1) Boletes of Eastern North America by Bessette-Roody-Bessette
2) Boletes from Belize and the Dominican Republic, Ortiz-Santana et al. Fungal Diversity 2007, 27, pp. 247-416 (see p. 305)
3) Ron Pastorino’s obs 3102
4) Dr. Roy Halling’s obs 204748

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Spore measurements and pic posted
By: I. G. Safonov (IGSafonov)
2017-06-14 21:48:40 CDT (-0400)
DNA sequencing results and discussion UPDATED (22-Mar-2017)
By: I. G. Safonov (IGSafonov)
2017-03-22 02:04:48 CDT (-0400)
nrLSU sequence MO179586
By: I. G. Safonov (IGSafonov)
2017-03-21 23:02:03 CDT (-0400)

> nrLSU partial sequence MO179586/Boletus aff. weberi (forward read from the 5’ end, 481 bp)
TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTTGAATCTGACGGTCTTTTGGCTGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCTGGGACCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGATCACCCCAGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGCTTGGGGATCAACCTTGCTTCTTCGTTGGG

> nrLSU partial sequence MO179586/Boletus aff. weberi (reverse read from the 3’ end, 915 bp)
TTTTTTAGTAGTGTGTTTATAGCCTTTCGTCGTATGCGTCGGTCGGGACTGAGGAACTCAGCACGGCTTTTTACAAGCCTTTGTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCATGCGAGTGTTTGGGTGGCAAACCCGAGCGCGTAATGAAAGTGAAAGGTTGAGACCTCTGTCATAGGAGGGCATCGACGCCCGGACCTGAGTCTTCGACGACGGACCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGTGTATTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAGCGGGCTGTCGCTTTGTTGGACTGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCGTCAGCGTTGAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGTCGTGAAGAAGCCTTGGCAGCGATGCTGGGTGGAACCGCCTCTAGTGC

Dave,
By: I. G. Safonov (IGSafonov)
2017-03-21 22:37:27 CDT (-0400)

Blackjack oak = Quercus marilandica.

Looks similar to the photo of B. weberi…
By: Dave W (Dave W)
2017-03-21 21:09:18 CDT (-0400)

seen in Boletes of E NA. BRB say this species occurs under longleaf pine, often with bluejack oak. So I’m wondering is you meant “bluejack oak” (Quercus incana) when you typed “black jack oak” in these notes.

nrITS sequence MO143371/179586
By: I. G. Safonov (IGSafonov)
2017-03-21 20:37:15 CDT (-0400)

> nrITS sequence MO143371-MO179586/Boletus aff. weberi:
GTGAACCTGCGGAAGGATCATTATCGAATTTCAAGGGAAAAAGGGAGGAGGGGAAAAAAGATGGTTTGGGAGGGAAAGGGGGAGATTGCTGTCGCTGGCTCTTTCTTTTCTTTGGGGGAAGAAGGGACATGTGCACGCGTTTTCCTTTCATCATCCTCTTTGTCTGGACCCCACCTCTCTTTCTCTCTCACACACACACCTGTGCACCTATTGTAGGTCTTCGAAAGAGGATCTATGTTTTCATCTATTGCATGTCTATAGAATGTGTAAAGTGTAATGGGAATCATATATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAGTATTTCCTCAACCATGTTGTTGTTGTTGGGCGGTCTTGATTGATTTCAAGGTCGACCCCACCCCTCTCCATGGCTTGGAGTTTGGGAGTTTGCTGGCAGCGTCGAGCTCTGTCGGCTCTTCTGAAATGCATTAGCAAAAGGGATGAGGCGTGTCCTTTGGGCGTGCACGGCCTTCGATGTGATAATATGATCGTCGTGGCTGGAGCGTTCCTTTGACCATGCATCGAACTCTAGGGTTTTCCCCCTGTTGCTTACAATCTGTCTCCTATTCCTTTGGTGAC

Created: 2014-09-19 17:22:21 CDT (-0400)
Last modified: 2017-06-14 21:48:10 CDT (-0400)
Viewed: 176 times, last viewed: 2017-06-19 20:34:15 CDT (-0400)
Show Log