Observation 181359: Phallus indusiatus group
When: 2014-10-01
( 1800m)
No herbarium specimen

Notes: Under oak.

The cap had a very strong, sweet odor. I found it unpleasant and nauseating, however my female friends didn’t. They couldn’t find any words to describe it other than very sweet. The net had a different odor, which I found to be like rotten meat. My friends thought it smelled strong, but not at all unpleasant.

Images

464340
IMG_0854.JPG
464333
IMG_0840.JPG
464334
IMG_0841.JPG
464335
IMG_0846.JPG
464336
IMG_0847.JPG
464337
IMG_0850.JPG
464338
IMG_0852.JPG
464339
IMG_0853.JPG
464341
IMG_0856.JPG
464342
IMG_0860.JPG
464343
IMG_0863.JPG

Proposed Names

58% (1)
Eye3 Eyes3
Recognized by sight: ITS DNA sequence revealed only an 86% match with Phallus indusiatus. The closest match was Phallus ultraduplicatus from China, at 95%.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-15 15:38:48 CDT (-0400)

TTGAGGGGGAGGTTCTCCCCTGACGACCCACACCTCTGTGCACTTTGGGGGGACTCGAGAGAGA
GAGAGAGACCCCCTGTTATGAATGCCCTTGTCTCTCGTGTGTATTTTGAAAGGCAAAGTCTTTGAAACACAACTTTCAAC
AACGGATCTCTTGGCTTTCGCATCGATGAAGAACGCCGCGAACGCGCGAAACGTAATGTGAATTGCAGAATTCAGTGAAT
CATCGAATCTTTGAACGCACCTTGCGCTCCTCGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAAGTCTCATCGGA
TAGGGGCCCCCTTGGGGGACCTCTTTTTCGGACTTGGACGGTCTTGCCTTCACTTTGTCGGTGAAGGGCTCGTCTTCAAA
TTCATCGGCGAGGGGTTTCGAGTCCTCCCCCAACGAGACGCGTGATAAGTCTTGCGTCGTCCGGGGGTGTTTAGGAAGCC
CCAGTCTCTCATCACTCTTTTTTTTAAAAAAAATAACACCCTGACCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGC
ATATC

Created: 2014-10-03 00:54:07 CDT (-0400)
Last modified: 2016-04-15 15:38:32 CDT (-0400)
Viewed: 183 times, last viewed: 2016-11-19 04:56:26 CST (-0500)
Show Log