Observation 188067: Psilocybe baeocystis Singer & A.H. Sm.
When: 2014-11-11
Collection location: Washington, USA [Click for map]
No herbarium specimen

Images

480668
P1190051.JPG
480669
P1190052.JPG
480670
P1190053.JPG
480671
P1190054.JPG
480672
P1190055.JPG
480673
P1190056.JPG
480674
P1190058.JPG
480675
P1190060.JPG
480676
P1190061.JPG
480677
P1190062.JPG
480678
P1190063.JPG
480679
P1190064.JPG

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS Sequence / phylogenetic tree
By: Alan Rockefeller (Alan Rockefeller)
2015-01-08 14:11:30 MST (-0700)

ITS sequence: ACCTGCGGAAGGATCATTATTGAATGAACTTGGCTCGGTTGCAGCTGGTCCTCTCGAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACCTTTTGTAGACCTGGATTAGTTAACTTTCCGAGGAAACTCGGTCGGGAGGATTGCTTTCACAAGCTCTCCTTGCAATTAACCCAGGCCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTATATTGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACCTTTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAATACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAATCTAGAGAAGTGTATCCGCGCTGGACCG

Phylogenetic tree:

This collection is about 2/3rds of the way down on this tree, and is labeled with the MO observation number.

The phylogenetic placement of this species is surprising. It is most closely related to Psilocybe fasciata from Asia and also close to P. semilanceata.

Created: 2014-11-11 12:09:25 MST (-0700)
Last modified: 2015-01-08 13:59:16 MST (-0700)
Viewed: 135 times, last viewed: 2016-12-01 06:02:37 MST (-0700)
Show Log